Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24600  (registered. 2007)
Contig Information
Length 816 bp
Clones 34 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 4
Wh_DPA20 Seed DPA20 4
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 8
Wh_MS Seed DPA5 of DT3DL CS wheat 11
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195623990|gb|ACG33825.1| 60S ribosomal protein L12 [Zea mays] >gi|195637596|gb|ACG38266.1| 60S ribosomal protein L12 [Zea mays] >gi|195639366|gb|ACG39151.1| 60S ribosomal protein L12 [Zea mays]
Score 791
Evalue 1.94055e-82
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24600
CAACTCCAGCCGCCGCCACACACTCCCCACAGCCAATCCTCCCCAGCCCAAGCTCGCAGCCATGCCTCCCAAGCTCGACCCGTCCCAGATCGTGGAGGTG
TATGTCCGCGTCACCGGCGGGGAGGTCGGCGCTGCGTCGTCCCTGGCCCCCAAGATCGGCCCGCTCGGTCTCTCCCCAAAGAAGATCGGAGAAGACATCG
CCAAGGAGACGGCCAAGGACTGGAAGGGCCTCCGCGTCACCGTCAAGCTCACCGTGCAGAATCGCCAGGCCAAGGTGTCCGTCGTCCCCTCCGCCGCAGC
CCTCGTCATCAAGGCGCTCAAGGAGCCCGAGAGGGACCGCAAGAAGGTCAAGAACATCAAGCACAGCGGCAACATCAGCCTCGACGACGTCATCGAGATC
GCCAAGATCATGAAGGTCCGCTCCATGGCCAAGGAGATGGCCGGCACCGTCAAGGAGATCCTTGGCACCTGCGTCAGCGTCGGCTGCACCGTCGACGGCA
AGGACCCCAAGGATCTGCAGACGGAGATCGACGACGGCGAGGTGGAGATCCCCGCTTAAGAAGGCTTGGCTTTGGGCAGGTTGTTATGTGAGGCTGCTGA
AGTAGTTTCTCCTATCTAGATGCTTCCTGATGCAGTTGAGAGAATGGATGTGATATCTTCACTTGTTCTACTCGTGCTGAAGAAGAAACTTTTGTCATGC
TTTAGTGGTTCCATTGTGAGACTATTTTTTACTGGTTTAATGAGTACCCTTGCGGAATCAATCAATGTTATTATGGCAGCTAGAATATCATATGTTGAGT
TTTGTCAAAAAAAAAA
page-top