Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24588  (registered. 2007)
Contig Information
Length 1311 bp
Clones 33 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 5
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_KMP Shoot grown under continuous light 2
Wh_PCDAM Anther at meiosis 6
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VABA Shoot with ABA treatment 2
Wh_VWD Shoot grown with dessication 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_00860 [Oryza sativa Indica Group]
Score 604
Evalue 1.98246e-60
Total Hit Count 204
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24588
TCCCCCAAGACCAAAAAAGGCCCCAGCAACCCAAGCGCGTCGACCCCATCCACAGTTGAATCTCTGAGTTTACTTTCAGAGAAGATTTTAGTCGAGATGG
CGCAGGCGATCGAGGCTCAGAGCGAGGGCGCGGAGGTGTACCACGGCGCGGCGCTGTGCGCGGAGAAGGCGGTGGAGCTGCTGGCCGAGACCAACATGCC
GCTGGGCCTGCTGCCGCTGGCAGACATCGAGGAGGTGGGCTACAACCGCGCCACCGGCTTCGTCTGGCTGCGCCAGAAGAAGGCGCTCACGCACACCTTC
AAGCAGATCGGGCGGCAGGTCTCGTACGGCACCGAGGTGACGGCCTTCGTCGAGGACCGCAAGATGAAGCGCATGACCGGGGTCAAGAGCAAGGAGCTCC
TCATCTGGATCACCCTCTGCGACATGTACATCGAGAAGGACGATCCCTCCAAGATCACCTTCAAGACGCCCACAGGGCTGGGGAGGACCTTCCCCGTCTC
CGCCTTCGAGAAGCAGGACGACGGCAAGGCCAAGGCCGCGGCTGCCGACGGCAAGGAGGCCGTCGTGGCCAAGTAGGTGAGGACGGCCGGCATACTCTAC
AAAGTTTGGATGAAGAGTCCTCGAGTCCAATATTAACTATATACAAAGTTTGGATGAAGAGTACTATTTGCTTTTATCTTTATAATAAACTACGGATTAT
ATAAGGGGTTGTAATACTCTGCTCCGGTGTTTTGCCGAGGGTTGTATCATGCATATGATCGTGCGATCTTTATAATCTTATATGTGCTGTTCGCTGCTTA
AAAAAAAACCTCGTGCCGAATTCGGCACGAGGCGTCGGGAACCGCCTGCTCAGCGCCACCGTCGAGTATGAGGAGACGGGATGGTACGACGGGCAGATAT
GGGTTAAAACCCCAGAAGTTNTAGCTNGTGATNGTNTTCTCGGATCATTTTCTGTGAAGCCGGTGCTGAACAGAGTGAAGTTCACCCTGGTGGGCCTGGC
GGTGTCGCTGACCCTNTGCATCCTCCTTTACGCCAACACCGAGAAGCCGAGGGAGCCGCTGGAGAACCCCGCCGGCGGGAGGGCCATCCCCGGGGTGTAC
AGTGACGCCGCCGTGAGGTCGTTCGAGCCCGATGCCTTNTGCGGGGAGCCCGACCTCGGCGGCGGCGACCAGTNGTAACTTTNGACGGTGGTTNTGGTGG
AAGGCGATGACAGGATCATNTATNTCATAGCATCCATCCTGTTCATCAGGGTGAAGTGGTGTAAATATCTAGCCGTACATAGCGATAGTCCATACGAAAA
ATGAAATCCCT
page-top