Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24565  (registered. 2007)
Contig Information
Length 1379 bp
Clones 33 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EMC Dormant seed with cold treatment after water absorption 3
Wh_KMP Shoot grown under continuous light 1
Wh_MS Seed DPA5 of DT3DL CS wheat 11
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 4
Wh_SHDr Shoot grown with dessication 3
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VHS Shoot with heat shock treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit adenosine kinase-like protein [Oryza sativa (japonica cultivar-group)]
Score 1670
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24565
TTTTTTTTTTGAATTCCACTGCATTCAAGCACTATCGTGGTCTGACCACGCTTCCGCATATACTTGGGATAAGACGGCCACAAGTAACACCCCATATAAT
GGCAACCATGCCTTATACCAAAGATAAAAGGTACCAATTATAGCAGTACAACAGATATCCACGGCCTTAAAATATAGGCCGGATCAGATGGAAAGCCTCA
AAATAATACAGGGAGAACAAGCCGAACCATTAAGTGGTTAAGTGTTGCTTTCCGTACCATCGCCGAATTTGGTTGGTCTAGTTGAAGTCAGGCTTCTCAG
GGTAAGTGCAGCCAGACTGCTGGATGATAACGTTTGCTGCGTAGCAACCGGCCTTTACGCAGTCCTCGATGCTCTTCCCTTGCACCAACTGAGAGAGGAA
GCCTCCAACAAACGCATCACCAGCGCCATTGGTGTCAACAAGCTTCTCCTTGGGCAATAGGATGACAGGGAATGTTTTCACCTTCCCATCCTCGGCCACA
ACTACTGGATCAGCACCCTGAGTAATCACAGCAATCCTCTTTTGTTTTCCAGAAGCCAGAGGCAGTTGTGAGATCTTCAAAGCGATCTCCTCGACATTCT
CAGTCTCCCACCCTCGGACTTTAGAGAAGATCCTTGCCTCAGTTTCATTTCCAAAGATATAGTCCGCATACGGAAGAACCTTCTCTTGGGCATCACGGAA
AAACTCGCAGATAAAGGGAGCGGAGAGGTTCATCAAGAAAACCTTGTTATTGGCAGCAGCATGCTCAGCAACAAGCTGAATAGATTCAGGGGACACCGTA
AGGAAAAAGCCAGCAATGTAGATGTATTTTGCTTTCTCAACTAGTGCCCAGTTCTCTGGCTTCTTTAGATGCTCAGATTTGTAGCAGTTCGCAGCAGATA
AGTTTGCAATCAATGACCTTTCGCCACCAACAACACATACAGCACATGTGCCTGTAGGAGCAGCCTCATCCTCATAGTAATGAGCAGTAACTCCTGCAGC
TTTAGCGGCGCTCTTCATCTCCTCACCATACTTGTCCTTTCCAATGCAACCCATGTAACTTGTTGCACCAGGAGTTTGAAGCATCCATTGGGCAACCCTG
ATAGAGTTCTGCGTGGCTCCTCCAGCAATGTATTCAACATTTTCCTTGCTGGACAACTCATCGTACATGGGCAAGTGCTTGTCCTCGGCGAGAATGGCAT
TGTTCGGCTTGACATCATACTTAGCGAGGAAGGCCTCGTCGACGACGGCGGAGATGTCGAGAAGGGGGTTGCCCATCCCCAGGAGCACACCCTCGAGGTT
GCTCGCCGCCATTTTCTTGCTCCTCTCGACGACGGCTGCGCAAGGAGGCGAGAGCGAGATCTGAGGTCTGCGTTGGCGA
page-top