Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24554  (registered. 2007)
Contig Information
Length 693 bp
Clones 32 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 3
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 12
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_SHC Shoot grown with cold treatment 5
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os09g0502000 [Oryza sativa (japonica cultivar-group)] >gi|113631817|dbj|BAF25498.1| Os09g0502000 [Oryza sativa (japonica cultivar-group)] >gi|125564262|gb|EAZ09642.1| hypothetical protein OsI_31926 [Oryza sativa Indica Group] >gi|125606230|gb|EAZ45266.1| hypothetical protein OsJ_028749 [Oryza sativa (japonica cultivar-group)] >gi|215767820|dbj|BAH00049.1| unnamed protein product [Oryza sativa Japonica Group]
Score 635
Evalue 1.75148e-64
Total Hit Count 432
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24554
CTCCCCTCACACTCCCTCCCATCTCCGCCGCCGCCGCCGCCGCTCGCCTTGCAAGATGGCGGTGCCTATCCTGAAGACGGCGATCGTGAAGAAGCGGGTG
AAGCACTTCAAGAGGGCGCACAGCGACCGCTACATCGGCCTCAAGCAAAGCTGGCGCAGGCCAAAGGGTATCGACTCCCGCGTCAGGCGGAAGTTCAAGG
GATGCACCTTGATGCCCAACATTGGATATGGTTCTAACAAGAAGACGAGGCACTACCTGCCCAACAAGTTCAAGAAGTTTGTGGTGCACAACGTCTCTGA
GCTGGAGCTGCTTATGATGCACAACAGGACGTACTGTGCTGAGATCGCGCACAACGTGTCCACCCAGAAGCGCAAGGCGATAGTGGAGCGTGCCGCCCAG
CTCGACGTCGTGGTCACCAACAAGCTCGCCAGGCTCCGCAGCCAGGAGGATGAGTGAAATGTTTCAAACAGTAGCGCTTTTGGATCATTTTGTTCCGTTC
CCTGTAGTAGACTTAATGCCGAATCTGGAGTTTTCTTCTCTGTTCGCCTTGTTGATTCGACGCTGTTGAACACCTTGCTATCGATGCTGGTCATGCTCTC
GTACTATAAGCACATTGACTTTGACGTGAAGTCCGGGTTGCCTTTAATCATCAGCTATGGAAAGATTTTCTGGGCCGCTTTTCAAAAAAAAAA
page-top