Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24550  (registered. 2007)
Contig Information
Length 1499 bp
Clones 32 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 6
Wh_EM Dormant seed with water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 5
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 5
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 4
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 1
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit mitochondrial ATP synthase precursor [Triticum aestivum]
Score 1049
Evalue 5.95697e-112
Total Hit Count 113
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24550
CACATTACAACAGCGATGCATGCATCCTGACAACAGGGTCATAACAAGAAAACTAAATTTGCGGCAACAATAGTACACCCTATATTGCCACACAGTACTT
TCTCACTGCAATATTCCCATGCATGTACCACAGCAATATTTTGTTTCTGCTGCAGTAACCTGCATGTCACATTGCAAGCTAGAGAATTATTAAGTACTAG
CTAATGCTAAAAGTAAGTGAAGGGAAACCGTACGTGGCAATGAAACTGCCACGGATTATTCGTCGTTGCAATACTGCCATAGGAAGGTCGATCATCATTC
TGCGAGAAGAGTGGAGTTGGCGGTGATGGCGCCGGCAAAGACAGCGTCACAGCCGCCGCTCTGGCAGCCTGCACCGCAATAGCCCGGGCCGACGGCACGA
GGGAGAGATCGAATCGGAGAAGAAGGAGCGGAGAGGCCTCTGCTGCCCTAGCTCCGCCGCCCCCGCACCGGCCATGGCGCTCGCCGCTCGCCTCGTATCC
CGCTCCCGACAGTTATATTCTGTCCAAGCTGCTTTGGCCAATGGAGGCGTCACTCAAGTCCGCTCATTTGCCAAGGAGGCAGCTCCTGTCAGCGGAGATG
ACCTATTGAAGGGCATCTTTTTTGAGGTGAAGAAAAAGTTTGAGACCGCACTTGGGGTCCTTAAGAAGGAGAAGATCACGATAGACCCAGATGACCCAAC
AGCAGTTGCTAACTATGCCCAAGTCATGAGGACTGTAAGAGAAAAGGCAGATCTTCTTTCCGATCCTCAGAGAATTAAACATACTATTGAGACTTTCACG
AAGGGCATCCCTGATGCAAGGACGTACTTGGATACCCTTCAGCAGCTCAGGAAAAAGAGTGGTCTCATAGATGATATGGGTATTGAGGATATGATGATGG
AAGCTCTTGAGAAAGTTGAGAAGGATATTAAGAAGCCTCTTCTGAGGAGTGACAAGAAGAACATGGGTCTCCTCTTGGCAGAGTTTGACAAGATAAACAA
AAAGCTTGGCATTCGGAAGGAGGATCTTCCCAAGATTGAGGAAAATCTTGAAATGGAACTTGCCAAAGCTGAGCTGACGGAACTTAAGAAGGAAGTTGTT
GAAGCAATGGAGGGTCAACTAAAGAGGGAGGAGTTTAAAGATGAGGCGATGCCTGACGTCAGGAAGTTGGACATTAGAAACTTCCTCTAGGTCCCTGATT
GATGATAACCCTTGGGGTGACCGATCTGTGATTTTTCTTTTCAAGTGACGGCAGGTGCTGTAAGCCACACCGAATGGATGTTATTGTTGCTTTTTGTAAT
AAAACTGCACCGAGAATACGACGACAGTCAACCGATGAGTTGCGTTGCTTGGTTACCTTCCGGCGTTGAGAGTTTTGTTTCTTAGGCTGGCAACGTGAAC
ATCAAGCGTTGCTGAATATGTGCCTGCGGCTGCTGTTGTATGTAGTAGCCACACATTATAATTATATGGGATGTTCCATTGTCTTGTTCAAAAAAAAAA
page-top