Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24549  (registered. 2007)
Contig Information
Length 858 bp
Clones 32 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 6
Wh_SHC Shoot grown with cold treatment 5
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_V483 Shoot grown under cold condition for 3days 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_18385 [Oryza sativa Indica Group] >gi|125592747|gb|EAZ32806.1| hypothetical protein OsJ_016289 [Oryza sativa (japonica cultivar-group)]
Score 149
Evalue 5.94353e-08
Total Hit Count 54
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24549
ATCGAGACGCAGAAAAACGTCCCCTGCGAGAGGGAAGGTAGGCGTCTACATTATTGAGCGCCACACCGGGCGACTCCAACGAACGATCGAACGTTTTACC
CTACCGGACAAAAATATGGGTCAAAAACATAGCTCGGGGACACACACACTGGGAACAGAGCAATCTCGTCCACCACCAGTCGTCACCCCGTACCGCACCA
CACCCTCGTGCCGAATTCGGCACGAGGTTCCTTCCCATCCTGCTCTGCTCAGCGCCTCTACTGCTTCCCCTCCGTCCACCGATCGAGTGAAAAAGCTCTC
CGTTCGCCGGAAGATCCACGACCATGGCGGGCACGGCCAACTGCATCGACATCATCCTCGCCATCATCCTCCCGCCCCTCGGCGTCTTCCTCAAGTTCGG
ATGCGGGCACGAGTTCTGGATCTGCCTCTTGCTGACCTTCCTCGGGTACATCCCGGGTATCATCTACGCCATCTACGCCATCACCAAGTAAACTAGCAAG
CCGTCCCGAGTGTTCCGCGACACAATATTTTCAGGATGATTTGATCTGTCTAGTCCCTCCTTGCCTGTGTGGGTTCTTTTAATTCTTTTCCGTGTGCGTT
GATGATGCGAATTCCTCTGTGGTTTCCATGGACCATGTGAAGAGCATCAGCTTCTGTATGTATATGTACTAGTATGATATATGGGAGTTTATATATGCTT
CCCGAGTGGGAATACTTCTTGTTAAAGTTAGATTATTGCCTCCCTGTTCAAGTCTGGACTCGGCAGTGATATGTATGTATAGTCGGGTTTCTCATTTGAT
TTCTTCAGTAATAATAATATAAATAACGAAGCATCAGGTTCTACTGGGAAAAAAAAAA
page-top