Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24533  (registered. 2007)
Contig Information
Length 910 bp
Clones 32 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 4
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 1
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 6
Wh_VABA Shoot with ABA treatment 2
Wh_VSCB Liquid cultured tissue 1
Wh_VWD Shoot grown with dessication 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100194356 [Zea mays] >gi|194695608|gb|ACF81888.1| unknown [Zea mays] >gi|195649741|gb|ACG44338.1| transcription factor BTF3 [Zea mays]
Score 639
Evalue 9.98342e-65
Total Hit Count 310
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24533
TTTTTTTTTTACCTCTAGTGATCAAATCACAGATCCATGGACAAAACAATATCAGTTATGATGGGGTACATAGGGCTGGGAATGGAACATTTAAAGACAC
GATTTGAGAATGAGGGCAACCAAAAGAGGCATGTAATTTGATGCAAAATTCCACCAACATATCAGACGAAACTCGCGTACATGACAAAACCGGTCCACTG
GCACAAATAAGGTAGGTCAGAGTTCTTGAAAGGGGAGGTCTCTAATGGCGCCGCTTAACTTATAACCCTTCACAACAGTAAACATGCATCAAAATCACGA
CTCTGCCTTTTTCTCTTCAGCGGCCTCTTCAAATGTCTCTCCAGGGACAAGCTCAGGAACATCATCATCGTCGTCAGCCTGAGCAGCACCTGCACTGGCA
CCAGCCTCGATGCCAGCAGCACCACCAGGGACCTGCTTTTGGAATTGCTCTGCAAGCCTCCGCAGGTTGTCCAAGTTGTCAGGACCAAGTTGATTGATAA
TTGATGGCAGCAGATCTTGCAGTTTCTTTGTCTGTGGAGTTCCACTGACTACCCATGTATTAGCACCAATTGAAGCTTGCACTTTAGGATTCAGAAACTG
AATAACCACATCATCCTTAAAGATGTTGACCTCTTCGATACCAGGAATGGTGTTCACTCCTACTCTTTTCAGGGTACTCTGGAGCCTTTTGTCATCTGTA
GTTGTGGTCTTGTGTACAGCCTTCTTCTTCCTGCGCATGCTACCCTTCCCCCCGGTGCGCACGGCACCTGCCATCTTCTTGAGCTTTTCAACATTCATCT
TGGCTGGGGGAGGAGCGGAAGCCGCGGCGAGGGCGCCGGCGGCGGCGCAAGGGGGGGAGGAGAGGATAGGAGCGGGAGAGACCAGGAGTGGGGGAACGGA
TAGGGGTCGG
page-top