Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24525  (registered. 2007)
Contig Information
Length 1329 bp
Clones 31 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 3
Wh_EM Dormant seed with water absorption 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 5
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 3
Wh_PCDAM Anther at meiosis 1
Wh_V4816 Shoot grown under cold condition for 16days 4
Wh_V483 Shoot grown under cold condition for 3days 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit leucine zipper protein zip1 [Triticum aestivum]
Score 362
Evalue 2.32989e-32
Total Hit Count 72
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24525
TTTTTTTTTTCTACAAAATCGGATGCTATATTGCTATTTAAGTATCAACACAAGTTACATAACAACTTCAGATATGCTTCTCCACCTGAAGCAAAACCGG
AACACATGCTCTGATGCAGTTCACTGCCACTTACATGTTGATGTGACTAAGCAAAAACTTGCCGAGTTTTAATACTTTACAGATGAGCACAGGAGGATGT
AGATCATGTTAATTAACCATGGATCATGTGCTCATTCAGAGACTCTTGAGGAGCATGATTATGTCTGAGAAGAAAGGCAGAGATGGATCCTTTTTCTACA
AATTCAGTAGACAAGCTTGGGCTCAAACTCGGCAAAATCAACGGAGCCAGACTCGATTGAGGGCATGAGGTACGCAGCGATGATCTCAGACACTAGTTGG
GCAATAAGAGGAACCCTCTTTAGGTTCTTCACCAGGGGCATGTCGTTGGACTCTCCTATAGAAATGATCTTCAGGTTGATATCTACCATCCTGTCTAGCT
TCCTCTTGAATTCAGGGTTCTCAACATCCGCCTCGTGCCGAATTCGGCACGAGGCTTCTTCAGCTGCGTCCAGATTGGGCTCTACTGCTGGTACCGCAAG
CCCAGCAACGCCGTGCTGCCCACTACTACCGCCGACGCCGGCAACGGCAATGGCGGCTCCGCGGACCAGCCGCAGGTGCAGGTGATCGAGCTGCCCGTGC
ACTCCGTCGCCATCCTGTCCGTGGGCCCCGTCCCGATCCTCGGCGTGCACAAGATCGAGGTCATCGCAGCAGAGCAGCAGACCGTCATCGACGTCAAGGA
CGCCGCCAAGGCGGCCGAGGTCGACCAGCCGGAGGTCATCGAGATCGTCCCCGCCCCCGCCGTGTGAGACAGACTTCCACCCCACCCAACCAACATCGAC
GACGACACGACACGACACGAGCATGCATGATACGCCACACGACATGCATGGAGATGGACAACTGATGGGTTTGGTTAATTAGTTAATTATTACTGAGTGG
TAGTATCATCGTACTGCAGGGTGTGCCCGCGTGTGGATTACTTACTTTACTTAGTTAATTTATTATTACTGGATTGTACTGCGTGGCGTTGGTTAAGTTA
TTATTACCTTCAGGTGTGTGCCTCGATCTCTCTTAATCAGTAGTATTAGTCCGCAGGTTGGTGTGGTGACAATAATAATAAGACACGACCTACTACTTGT
GCATGTTGTGATGCATGCATGTGTACTGGTCATTCATGCTGTATGTTGCAGTCTCTCTCGTCTCAGACCTTGCCTGATTTGTGTCATCCATCAATCGATC
AGTAAAATAGACTGCAATATGACAGTATA
page-top