Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24517  (registered. 2007)
Contig Information
Length 845 bp
Clones 31 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 7
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 2
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_09485 [Oryza sativa Indica Group]
Score 654
Evalue 1.60091e-66
Total Hit Count 217
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24517
AGCGCCGGGCTCCGGGCTGTTCCAACCTTCCGCAGCCACCACCACCCCAACCCAACCCACCGGAGCAGACCAAGGCGGCGCCGCGGCGACCTCATCTCCG
GCCAAGGGAAATGACTACCGTTCCGGGGTCTCTGGTGTGGGAGCTGGTGAAGAAGAACAACTGCTTCTTGATCAAGCAGTTCGGCAACAGCAACGCCAAG
GTGCAGTTCAGCAAGGAGCCCAACAACCTCTACAATGTCCACTCCTACAAGTTCTCGGGCTTGGCGAACAGCAAGACCGTGGCGGTCCAGCCATCAGCAG
GAGAGGACAAGGCTGTCATCCTTTCCACGACCAAGACCAAGAAGCAGAACACCCCTGCCAAGCTCCAGCACAAGACTCTGATGCGCAAGGAGTTCCGCAA
GATGGCCAAGTCTGTCAAGAACCAGGTCTGCGACAACTACTACAGGCCTGATCTGACCAAGCCGGCCCTTGCAAGGCTGAGCGCCGTGTACCGCAGCCTC
CAGGTTTCAAAGTCTGGGATCAAGAAGAAGAACAGGCAGCCAACTAAGCTGTAAAACTTGTTAAGCTCGCCTTTCAGCGCTCATGTTACCATGTCTGTTC
CGACAGTTTTGAGTCATAAGTGAGACCCTTGGAGGAACCATGTTACAAACCCGCCCTAGTTTGTACCCTGACAGTGTTAGAAAATGGTTTGTGTCGATCT
ATAACTATTGTTTGATTCTCACTGGTGATTGCTGCTTGTGTCGTCGAATTTGTCTTCTGGGGTTCCTCCCAGATTCTGCAGCTTATGTTGGGCGATGGTA
CTATGTTACTTAGTAGCATTGACATTGCTAGTGTGAAAAAAAAAA
page-top