Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24487  (registered. 2007)
Contig Information
Length 764 bp
Clones 31 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 5
Wh_EMI Dormant seed with water absorption after breaking 5
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 1
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 4
Wh_SHDr Shoot grown with dessication 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 60S ribosomal protein L24 >gi|1154859|emb|CAA63960.1| L24 ribosomal protein [Hordeum vulgare subsp. vulgare]
Score 563
Evalue 4.72681e-56
Total Hit Count 454
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24487
TTTTTTTTTTGACAAGAACCAACATAAGTACCATTCATTATAAATAAACTCATCGAGACAATCCAAAACGTTAACACCATTCAGCCTCACAGATAAGGTG
CAAATTCAAGATGGCGGGGTAATAACTTGACAAAGGTCTATGATAGTAGGATAGGAAACAAGGCTAGGCAGCACAATTCTATGTCTATGGCGTAATCGAC
TTTCAACGCTTCCCGCCGCCACCGCCAATCTTTGGGCCCTTGGAACCCTTCTGCACGGCGCCCTTGCCCCCCTGTGACTTCTGGGACTTGGTCACCTCTG
CCTTCTTGGCCTTCTTCTCATCCTTGGTCTTCTTGATGCGCTCCTTGATCTCACGGAGAGCAGCTTCTCGGGCAGCATCACGGACTTCAGGCTTCTCAGC
CCTCTTCTTCTGGATAACTTCCAGAGTGGCACCAACAATCGACCGTGAGTACGGCTTCTTGGTGGTGCGGCGCCTCTTCTTGGCAGCCTCAGCATGGATG
TCCTTCTTGTGCTGCTTCCTGTACATTGCTGTCCAGCAAAGCTTTGCAGGCTTCAGGCGGTTGTGGAAGTAGCGCTTGCATTTTGAGTTGGCAAAGAGGA
AAACCTGCGAATCCGAACGAATGAACCTGATACCCTTCCCAGGGTAAATCTTCTGGCCGCTAAAACGGCAGAGCTCGGTCTTCAGAACCATCTTCTCAGC
CTTAGAGAACTTTCACAAGCTCCTACCTTGGGCGAGGAGGAGGCGCGGCGGCGGCGGATGGGGG
page-top