Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24479  (registered. 2007)
Contig Information
Length 1544 bp
Clones 30 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 4
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 4
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ATP synthase beta subunit [Triticum aestivum]
Score 2087
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24479
TTTTTTTTTTAAACCTGAACAAGAAACAGCTTCGCCAACAACAATAAACTAAACCAATTCATGATCTGTCGGATCTGCATTACAAAGGGCACAAGTGTTT
TCCAAGCCAAGAGTAGTGTTGCTGTTGTGCAGACTAAACCAATGTCACTGCAGTTGCTTATTACGGGTAAATTGGAGTAAAAACGAACAAAAACAAGGAT
CCCTCAGCAGGAGCTGGCACACTCCTGCTCGTGAGCAAGTCTCGGGCGAACAGCTGAAACCCAAAAAATTTAACTTGTACAGAGCGGTGGTAACACCTCG
TCATCAGGCATTCTCGCTGGCGATCTTCTCTGCCTTGGCGATGACTTCGTCGATGCCTCCAACCATGTAGAACGCGTGCTCCGAGATGTCGTCGTACTTG
CCGTCCAAAACACCCTGGAAACTTTGGACACCCTCCTTTAGGTCCACATACTTCCCTGGAGCACCAGTGAAAACTTCGGCAACATGGAAAGGCTGGCTCA
GGAACTTCTGGATCTTCCTTGCACGAGCAACCGTCATCTTATCATCTTCACTGAGCTCATCCATACCCAAAATGGCAATGATATCCTGAAGATTCTTGTA
GTTCTGAAGAACCTTCTGGACACCACGGGCAGTGTTGTAGTGATCCACACCCAGAACGTGGGGAGAAAGCATTCTTGATGTCGAGTCCAAGGGATCAACA
GCAGGGTAAATGCCCAGCTCAGAAATCTGTCGTGACAACACAGTAGTAGCGTCAAGATGGGCAAAGGTGGTAGCAGGAGCAGGATCCGTCAAATCATCAG
CAGGCACATAAATAGCCTGGACGGATGTAATAGAACCCTTCTTTGTCGTCGTAATCCGCTCTTGCAGTCCTCCAAGATCGGTAGCAAGAGTTGGTTGGTA
TCCCACAGCAGATGGAATACGTCCAAGGAGAGCAGACACCTCAGAGTTTGCCTGGGTGAAACGGAAAATGTTGTCAATAAACAGGAGCACATCTTGTCCT
TCGGCGTCACGGAAATGTTCAGCAACAGTCAAACCAGTAAGACCAACACGAGCACGGGCACCCGGGGGCTCGTTCATTTGCCCGTAGACAAGAGCACACT
TGCTTTCAGCCTGCTTCTCATCGAGCTTAATGACACCACTTTCAATCATTTCCCTATACAAGTCATTACCTTCACGGGTACGTTCTCCGACACCAGCAAA
AACAGAGAAACCACCGTGGGCCTTGGCAACATTGTTGATCAACTCCATGATAAGAACAGTTTTACCCACTCCTGCACCACCGAAGAGACCAATCTTCCCA
CCCCTTTGGTAAGGTGCAAGCAAATCCACGACCTTAATTCCAGTAACAAGAATTTGCTGCTCTGTGGCTTGCTCAACAAAAGCAGGGGCCTCACGATGAA
TAGGAAGGAAGTCGTGTGTCTTTATGTCACCCTTGTGGTCAATTGGCTCACCAATAACGTTAATGATACGTCCAAGGGTGGCCCTCCCAACAGGAACAGT
GATGGGAGATCCGGTGTTGAGCACTTTCTGGCCGCGCACGAGCC
page-top