Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24471  (registered. 2007)
Contig Information
Length 678 bp
Clones 30 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 8
Wh_SHC Shoot grown with cold treatment 3
Wh_SHDr Shoot grown with dessication 6
Wh_V4816 Shoot grown under cold condition for 16days 4
Wh_VABA Shoot with ABA treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Chain A, Crystal Structure Of Barley Thioredoxin H Isoform 2 In The Oxidized State >gi|186972809|pdb|2VLT|B Chain B, Crystal Structure Of Barley Thioredoxin H Isoform 2 In The Oxidized State >gi|186972810|pdb|2VLU|A Chain A, Crystal Structure Of Barley Thioredoxin H Isoform 2 In Partially Radiation-Reduced State >gi|186972811|pdb|2VLU|B Chain B, Crystal Structure Of Barley Thioredoxin H Isoform 2 In Partially Radiation-Reduced State >gi|186972812|pdb|2VLV|A Chain A, Crystal Structure Of Barley Thioredoxin H Isoform 2 In Partially Radiation-Reduced State >gi|186972813|pdb|2VLV|B Chain B, Crystal Structure Of Barley Thioredoxin H Isoform 2 In Partially Radiation-Reduced State >gi|32186042|gb|AAP72291.1| thioredoxin h isoform 2; HvTrxh2 [Hordeum vulgare subsp. vulgare]
Score 541
Evalue 1.32145e-53
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24471
TGGAACATCACAATAGCCATAGCCTATAGCCGAACAACTGGATTAGATCAGCTCCTTATGAAAATCAACCATTTACCGAATAAAGTCACACTTGATTCAC
CATCATCCAACCAACAAGTAACAAGCAGTACACAGGATATAAGGTGCCATTAGAGGCACCGCTTCTTGAGCCACAATTTTATTTAGGCGAATACTACTCC
GCTAGGTGATTACTGGGCCGCCGCGTGTAGCCCAACCTTGTTCGTCAGTTCCTCCTTGATAGCTCCCACAACCCTGTCCTTGACATCTCCTTCCTTAATG
AACAGGAAGGTTGGCATGGCCTCAACGCTGAATTGCTCCGCAATGGGCTTCAGTTCATCGACATCGACCTTGAGGAAAACAGCATTTGGGAACTTCTTGG
CGAGATCAGCGAAAACTGGAGCCATGATGCGGCATGGTCCACACCATGATGCAGTGAAGTCAACCACCACCAGCTTCTTGGCGGCGTTGGCCTCCTCGAT
CTGCATGGTCCACTGCTCCAGGGTGTGGACGGAGATCACCTCCCCCGCCCCCACCGCCGCCGCCGTTGCCGTCGCCGCCGACGCCGCCATCTCTCTCTCT
CTCTTCTCGGCAAGCACCGCTTGTTGATTTCTCACGCGCACTTTGTTGTTGCCTTGTGGGCTCTGTCTCCAATCCCGG
page-top