Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24468  (registered. 2007)
Contig Information
Length 643 bp
Clones 30 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 5
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 3
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 4
Wh_SHC Shoot grown with cold treatment 8
Wh_V483 Shoot grown under cold condition for 3days 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=40S ribosomal protein S27; AltName: Full=Manganese efficiency-related protein 1 >gi|14140095|emb|CAA59732.2| putative zinc finger protein [Hordeum vulgare subsp. vulgare] >gi|14495006|emb|CAC42134.1| putative ribosomal protein S27 [Hordeum vulgare subsp. vulgare] >gi|14495008|emb|CAC42162.1| putative ribosomal protein S27 [Hordeum vulgare subsp. vulgare] >gi|14495010|emb|CAC42163.1| putative ribosomal protein S27 [Hordeum vulgare subsp. vulgare]
Score 403
Evalue 1.19339e-37
Total Hit Count 344
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24468
TTTTTTTTTTACAAGCAACAAACGATTCAAGTCATATACCATAGAGGGCAAGCAACATCAGAAGGAACAACAATTCACCAGACAACCATATTTCCTGGCA
GGAACTACTAGTCTGATCTCACAGGCCAAACAGAACATAGTACAGTGTCATAGTAATATTGCTCGAGCTAGATACCAAATTACCAAAGATGGATTCAATT
TGCCGACATTGCAAAATTTTCAGACCAACACCCTTGAAAAACTAACGAGTTCAACAACAGCTTGCTTTTTAAGATAGCCTTCGGTTTAGTCGCCCTTGCG
GCGGAAGGAGCAACCCTCGGTGAGCCTGGCCTTACCACCCGTTGGCTGGCAGAGCACTGTTTGGCAGCCTGGGCACACCACAACAGTCTGTGAGTGGCTG
AACACAGTAGTGATGTTGAAGCAGCCCTGGCACTTGACGTCCATGAAGAAGGAATTGGGGGACTGGACGAGGCGCTTCTTCTTGTGCTTGAGCTTCTCGA
GCTCCGCCGGCGGGTTCAGCAGGTCGATGTCGTTCTGCAGCACCATCGTGGGAGGCTAGGGTTTGCTCGGGAACCGCGCTCTCTGGTCTCCAGCAGCGGC
AATCCGAAGAGGAGGCGGCGGCGGCGGCCCTCGTGCGGCACGA
page-top