Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24446  (registered. 2007)
Contig Information
Length 942 bp
Clones 30 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_SHC Shoot grown with cold treatment 3
Wh_SHDr Shoot grown with dessication 3
Wh_V4816 Shoot grown under cold condition for 16days 5
Wh_V483 Shoot grown under cold condition for 3days 7
Wh_VABA Shoot with ABA treatment 3
Wh_VWD Shoot grown with dessication 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit stress responsive protein [Triticum aestivum]
Score 1099
Evalue 4.8098e-118
Total Hit Count 91
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24446
TTTTTTTTTTGTAACGTTGTATATCACCTCATTATATATATATGTGATAGGCCACCCCTAGAGGGTTGTGCCGGTTCCCCCCAAAGCCTATTGTCTTACA
CTGTGCATGCGTATTTCATTGTTTTTACGTATCACGAAGGTCCTTTATTGTTACGTAACTTGTCATTACACACACAAGCACAACAGCCTCCGTTATTCTG
CGGGGTAGGTAGCGAGAGACGCATGCATGTTGTCTATCCGGGACGGTCCACATGACATCGTTTCTTCAGTAGATACGTACGTACGCATGTGTGGATATCT
CGATCTCCCCGCGTACGTGCACGAGCCATGCATGGCGCGCGCTGGCTGGCTGGCTCAGTAGTACGGCTGGAGCTTCCAGCGCTGGTTGTCGCCCTCGCAC
CACTTCCAGAGCACGACCTCGGTGCCGTCGCGCACGCCGCCGTGGTACTTGTCGCCGTTGAGGGCGTCGAAGTTGAGGTAGATGTTGTTCACCATGCGCA
CGCACCTGAACCCGTTGCCCACGTCCCTGCTCTCCGTCCACAGCACCGACTCGTCCAGGTAGTCTGGGTTGTACGGCACCAGACGCACAGGGTGTGACTG
GCCGAGGGAGTGCTTGATGGCCTGCCCGGTGGCCTTGTTCACCATGGCGAAGGCGGGGTAGCCCTCCTCGTCCTTGATGCTGGTGCTCCACCTCATGTCC
TTGATCCAGTGCTGGTAGTCGTCCTTGGGGTTGGCCGGCGCCAGCACCACCTTGCCGTTGCGCACGGACATGGCGTAGTTGGGGTTGGCGCGGCAGTAGA
TCTTCACCGTGGGCTGCGGCGGCATCGGCCGCCCGCCGCAGTTGCCGTCGATGTTCACCTGCGACATGCCGTACGGCACCGGCGCCGCGTACCCGGGCGT
CGCCATCCCGTACCCGCCGTAGGTCTCGCGGTAGTAGTCCAT
page-top