Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24444  (registered. 2007)
Contig Information
Length 660 bp
Clones 30 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 4
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 6
Wh_VHS Shoot with heat shock treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit glycoprotein [Bromus inermis]
Score 592
Evalue 1.50983e-59
Total Hit Count 302
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24444
GCCCGCCCACCCGTCTCCTCGCCTCGCCGTCTCGCCCCACGCCGCCGACGCAAAGATGCCGTTCAAGAGGTTCGTCGAGATCGGGCGCGTGGCCCTGGTG
AACTACGGCAAGGACTACGGCCGCCTCGTCGTCATCGTCGACGTCGTCGACCAGAACCGGGCACTTGTGGATGCTCCTGATATGGTCAGGTGCCAGATGA
ACTTCAAGCGTCTTTCGCTGACCGACATCAAGATTGACATCAAGCGTATCCCTAAGAAGGCAACTTTGATCAAGGCCATGGAGGAAGCAGATGTGAAAAC
CAAATGGGAGAACAGCTCATGGGGTAAGAAGCTTGTTGTCCAGAAGAGAAGAGCATCGCTGAATGACTTTGACAGGTTCAAGGTCATGTTGGCTAAGATT
AAGAGGGGTGGTGCGATCAGGCAAGAGCTTGCCAAGCTCAAGAAGGAGGTTGCTGCTTAGATTATCTTAGTGGATGGCATGTTGAGTTTTTTGTTCCAAG
TTGGATCTGCTCTATGTTCCAGTGTTCTTAAAGCCAGAATTAGTACAACTGTTTTCGGAGAACTACTTCATATTTTGTCATGGCTGTTATTGAATACCCA
AGCTAGTTTGCTACAGATGTGCCTCTTGCCTTAATTCATTTGTGATAAACAAAAAAAAAA
page-top