Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24443  (registered. 2007)
Contig Information
Length 1407 bp
Clones 30 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 7
Wh_OKCS Seed DPA5 4
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VHS Shoot with heat shock treatment 9
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_07899 [Oryza sativa Indica Group]
Score 1820
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24443
TTTTTTTTTTGATGGCAGATCAAGATGTATCTTTGTCGTGAATACTACAAAGTATGCAATTTCACTTGAAGAAAAATGTGCCATACTACAATTTCACAAG
AGCCTTCCCTAAACGCATAATAACAACTACATAGCATTTCGCAAAAGAGTAAATGAGGAAAATTCTCACGGTGGATATCCTCCATCCACATTACTGAATG
ATATTATTGATGACACCGGCACCGACGGTCTTGCCACCTTCACGGATGGCAAACCTCATTCCCTGCTCACAAGCCACAGGCTGGATGAGCTCCACAACCA
TCTTGATACGGTCACCCGGCATGCACATCTTTGCCTCCTCATCCTTGTCGTTCATAATGTTTGTCACATTCCCCGTGACATCAGTAGTCCGCATGTAGAA
TTGCGGACGGTAACCAGGGAAAAATGGGGAGTGCCGGCCACCCTCCTCCTTCTTGAGCACATACACAACAGCCTCAAACTTGGTGTGTGGCGTGATGGAA
CCGGGCTTTGCCAACACCATGCCTCTCTCAATGTCTTCCTTCTGCATACCACGGAGCAGAAGCCCAACATTGTCCCCAGCAATGGCATCATCCATGGTCT
TCTGGAACATCTCAACACCAGTGACGGTGGCATTGCGGGTCTCCCTGATGCCCACGAGGTCGACTGGGTCCCCAACCTTGACGGTGCCACGCTCGATACG
GCCAGTGGCAACTGTACCACGACCAGTGATGGAGAAGACATCCTCAACAGCGAGCAAGAAGGGGAGGTCGGTCTGCCTCTGCGGGACAGGGATGTGGGTA
TCCACGGAATCAATCAAGGAGAAGATGCCATCCACCCACTCGTTATCCCCACGCTTGAGGCCAGGGGTGGCCATGAGGGCCTCGAGCGCTCTGAGTGCAG
AGCCGGAGACGATTGGCACATTGTCACCATCGTACTCATAGGCCGTGAGCAGCTCGCGGACCTCGAGATCGACGAGCTCGAGCAGCTCCTCGTCGTCGAC
CTGGTCCTTCTTGTTGAGGAAAACAACAATGCTGGGGACACCGACCTGCTTGGCGAGCAGGATGTGCTCCTTGGTCTGCGGCATGGGGCCGTCGGCGCCG
GAGACGACGAGGATGGCGCCGTCCATCTGGGCGGCCCCGGTAATCATGTTCTTGACGTAGTCGGCGTGACCGGGGCAGTCGACGTGCGCGTAGTGGCGCG
TCTCCGTCTCGTACTCGACGGTGGCGGTGTTGATGGTGATACCACGGGCGCGCTCCTCAGGGGCGGCGTCGATCTCGTCGTACTTCTTGGGCGCGCTGCC
CCCGACGGAGGCGAGCACCATGGTGAGCGCGGCGGTGAGGGTGGTCTTGCCGTGGTCGACGTGGCCGATGGTGCCGATGTTGACGTGGGGCTTGTTCCGC
TCGAACT
page-top