Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24432  (registered. 2007)
Contig Information
Length 744 bp
Clones 29 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_EMC Dormant seed with cold treatment after water absorption 5
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 3
Wh_PCDAM Anther at meiosis 6
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 9
Wh_V483 Shoot grown under cold condition for 3days 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_20483 [Oryza sativa Indica Group]
Score 625
Evalue 2.92009e-63
Total Hit Count 323
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24432
TTTTTTTTTTAGCCAAACGATACGGATTTTTATTCAGTCGGCAACATCTTAGACAAACCATACTGATATGCCGGTACAGCAGCAGCATAATAATCAGGCG
ACAACACAACTTGCATCAAGCAAGACACAGTTCGACAAGCGGGCGGCAATATATATATATGCCTTATGCCTTCAATATAGAGAAGAGCCGGCTGGCGGTT
CGAGCATTTATCGGAGGCGGCTTCGGCTTAGAAGCCGTGGATCTTGATGAGCTCCTTCTTCGCAATCCCAGCCTGGACTAGGAAAGTAGCAACATTCTTA
CGCTGATCACCCTGAAGCTGAATGACCTGGCCTAGCTCCGGATCCTGGACTACTGTGCCATTGCAGCAGAATTCCTTCTTGAGATCCTTGAGGATCTTGT
TGTAGCTGAACTCCTTCTTCAGGCCCTGGACAGTGGTCAGACTCTTCCTGCCGTTGCGCTGCTGGATGCGCACATGCACATAATCTTTTGCGCCGGGGCC
TGCACCAGCATCCTCAGCATTTGCCTCAGCAAAAGGATCGAAGGCAGATGGCAGAGTAACGTCGAGATCAGACATGAAACTTTGTTGTTGAGGTTTGACT
GGCACCCAACAGATTAAGGTTTCTCTTGTTGGCCTTTATGTGGAAGCTTTTGCTGGCCGAGCGCACGCGACAGGAGAGGGAGGGGACGCGGTGCGGTGCG
GTGCGGTGCGAGAGAGAAAGAGAGAGAGAGAGAGCGGCACGAGG
page-top