Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24431  (registered. 2007)
Contig Information
Length 2843 bp
Clones 29 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 6
Wh_EMC Dormant seed with cold treatment after water absorption 3
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 3
Wh_SHC Shoot grown with cold treatment 6
Wh_SHDr Shoot grown with dessication 3
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0519900 [Oryza sativa (japonica cultivar-group)] >gi|49387779|dbj|BAD26337.1| putative elongation factor 2 [Oryza sativa Japonica Group] >gi|113536503|dbj|BAF08886.1| Os02g0519900 [Oryza sativa (japonica cultivar-group)] >gi|119395216|gb|ABL74569.1| elongation factor 2 [Oryza sativa (japonica cultivar-group)] >gi|125539668|gb|EAY86063.1| hypothetical protein OsI_07431 [Oryza sativa Indica Group] >gi|125582310|gb|EAZ23241.1| hypothetical protein OsJ_006724 [Oryza sativa (japonica cultivar-group)]
Score 1197
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24431
CTCTCTGGGAGCGCCGCCGCTTCCTCATCTCTCAGACTCTCGCCTCTCGGCTCGGGAGGCGGAAGCGAAACCCCAAGGAACCATATTTGCAGTGTGACAT
TCAAACACAGTCAAGATGGTGAAGTTCACAGCGGAGGAGCTCCGCGGAATCATGGACAAAAAGAACAATATCCGTAACATGTCGGTTATTGCTCATGTAG
ACCATGGCAAGTCTACTCTTACGGATTCCCTTGTGGCAGCTGCTGGGATTATTGCCCAGGAAGTTGCTGGTGATGTTCGCATGACTGATACACGTGCAGA
TGAGGCAGAGCGCGGTATCACAATCAAATCCACCGGTATCTCTCTTTTCTATCAGATGACTCCTGAATCACTCGAGATGTACAAGGGCGATCGCGATGGG
GATGAATACCTGATCAACCTTATTGATTCACCTGGTCACGTTGACTTTTCTTCGGAAGTCACAGCTGCTCTTCGTATCACTGATGGAGCTTTGGTGGTTG
TTGACTGTATTGAGGGTGTGTGTGTGCAGACTGAAACTGTGCTGCGCCAAGCTCTTGGTGAGAGGATTAGGCCAGTCCTTACTGTGAACAAGATGGACAG
ATGCTTCCTTGAGCTTCAGGTGGAAGGTGAGGAAGCATATCAGACTTTCTCCCGTGTTATCGAAAATGCCAATGTCATCATGGCAACATATGAAGATGTG
CTCCCTTGGGGATGTCCAAGTGTACCCTGAAAAGGGGACTGTTGCATTCTCTGCTGGTCTGCATGGGTGGGCTTTCACCCTTACAAACTTTGCTAAGATG
TATGCCTCCAAGTTTGGAGTTGACGAGGCAAAGATGATGGAGAGGCTGTGGGGTGAGAACTTCTTTGACCCAGCCACAAAGAAATGGACCTCCAAGAACA
CTGGGACAGCTACCTGCAAGAGAGGTTTTGTTCAGTTCTGCTATGAGCCAATCAAGCAAATCATAGCCACCTGCATGAATGATCAGAAGGATAAGTTGTG
GCCTATGTTGAAGAAGCTTGGTGTGACCATGAAGAATGATGAGAAGGACTTGATGGGCAAGGCTCTCATGAAGCGTGTGATGCAAACTTGGCTGCCTGCC
AGTCGTGCTCTGCTTGAGATGATGATATTTCACCTCCCCTCTCCTTCAAAGGCCCAGAGGTATCGTGTGGAGAACTTATACGAGGGCCCCCTTGATGACA
TATATGCAAATGCTATCAGAAACTGTGACCCTGATGGTCCTCTTATGCTGTATGTCTCCAAGATGATTCCAGCATCTGACAAGGGTAGATTCTTTGCCTT
TGGACGTGTTTTTGCTGGGAGGGTTGCCACTGGGCATGAAGGTCCGTATCATGGGTCCCAACTTTGTTCCTGGCCAGAAGAAGGATCTGTATGTGAAGAG
TGTCCAGCGTACTGTTATCTGGATGGGAAAGAAGCAAGAGTCTGTTGAGGATGTTCCCTGTGGTAACACTGTTGCGTTGGTTGGTTTGGATCAGTTCATC
ACAAAGAATGCAACCCTGACAAATGAGAAGGAAGTTGATGCCTGCCCAATCAGGGCAATGAAGTTCTCTGTGTCCCCTGTTGTGCGTGTTGCTGTTCAGT
GCAAGGTGGCCTCTGATCTTCCCAAGCTTGTTGAAGGTTTGAAGCGTCTGGCAAAGTCTGATCCTATGGTTCTCTGTACCATTGAAGAGTCTGGTGAGCA
TATCATTGCTGGAGCTGGAGAGCTTCACCTTGAAATCTGTTTGAAGGATCTGCAGGATGACTTCATGGGTGGTGCTGAAATTATTGTTTCCCCTCCTGTC
GTCTCCTTCCGTGAGACTGTTCTGGAGAAGTCCTGCCGCACTGTCATGAGCAAGTCCCCGAACAAGCACAACCGTCTTTACATGGAAGCTCGCCCCTTGG
AGGAGGGACTGGCTGAGGCCATTGATGACGGGCGCATTGGCCCCGCGTGACGATCCTAAGGTGCGTTCCAAGATCCTGTCTGAGGAGTTTGGCTGGGACA
AGGATCTTGCCAAGAAGATTTGGTGCTTTGGACCTGAGACGACTGGACCCAACATGGTCGTTGACATGTGTAAGGGAGTGCAGTATCTCAATGAAATCAA
GGACTCTGTTGTGGCTGGGTTCCAGTGGGCGTCAAAGGAAGGCGCGTTGGCTGAGGAGAACATGCGTGGCATTTGCTTTGAGGTCTGTGATGTTGTTCTC
CACACTGATGCTATTCACAGGGGTGGTGGTCAGGTCATTCCCACGGCCAGGAGGGTCATTTATGCTTCCCAGCTCACTGCCAAGCCAAGGCTGCTGGAGC
CTGTGTACCTGGTTGAGATCCAGGCCCCGGAGAATGCACTTGGTGGCATCTATGGTGTTCTGAATCAGAAGAGAGGGCACGTGTTCGAGGAGATGCAGAG
GCAAGGTACCCCGCTCTACAACATCAAGGCCTACCTCCCTGTCATCGAGTCCTTTGGGTTCTCAAGCACCCTGAGGGCCGCGACGTCCGGCCAGGCATTC
CCCCAGTGTGTGTTTGACCACTGGGACATCATGGCTTCTGATCCTTTGGACCCTGGCACCCAGTCGGCGACGCTCGTCACGGACATCCGCAAGAGGAAGG
GCCTCAAGGAGCAGATGACCCCTCTGTCCGATTTCGAGGACAAGCTCTAAATTTTTGGTGCTGTTATCCCATACCTGCTATTGTGTTGTTAAAGAGAGCT
GCACTATTTTGTATCGATGAGTCTATCTTACTGTCTTGCTGTTAATGACCTATTTGTCGTGATACTGGGAACTATGTTTTGATGTCTGGTGATGTAACGG
ATGTTTTACTTAGATTATGTATCTGTTGTCCACTGGTTCTTTG
page-top