Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24424  (registered. 2007)
Contig Information
Length 1957 bp
Clones 29 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 13
Wh_KMP Shoot grown under continuous light 1
Wh_RDr Root of dessiccated seed 1
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 3
Wh_VABA Shoot with ABA treatment 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Inositol-3-phosphate synthase; AltName: Full=Myo-inositol-1-phosphate synthase; Short=MI-1-P synthase; Short=IPS >gi|3152731|gb|AAC17133.1| myo-inositol 1-phosphate synthase [Hordeum vulgare subsp. vulgare]
Score 2592
Evalue 0
Total Hit Count 417
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24424
CCGCACTCGAAAACCTCTCTCTCTCTCACTCCAACAGTTTTGCAGGAAAGAGAGGGAGAGATCGATCTTGCGTTGCCAAGATGTTCATCGAGAGCTTCCG
CGTGGAGAGCCCGAACGTGCGGTACGGCGCGGGGGAGATCGAGTCGGAGTACCGCTACGACACCACGGAGCTGGTGCACGAGAGCCACGACGGCGCCTCC
AAGTGGGTCGTCCGCCCCAAGTCCGTCAACTACCACTTCAAGACCAACACCACCGTCCCCAAGCTCGGGGTGATGCTCGTGGGGTGGGGCGGCAACAATG
GCTCCACACTCATGGCTGGGGTCATCGCCAACAGGGAGGGGATCTCATGGGCGACCAAGGACAAGGTGCAGCAGGCCAACTACTTTGGGTCCCTCACCCA
GGCCTCCACCATCAGGGTCGGGAGCTACAACGGAGAGGAGATCTATGCGCCCTTCAAGAGCCTCCTGCCCATGGTAAACCCAGATGATCTTGTGTTTGGT
GGCTGGGACATTAGCAGCATGAACCTGGCTGATGCTATGACCAGGGCCAAGGTGCTGGACATTGACCTGCAGAAGCAGCTCAGGCCCTACATGGAGTCCA
TCGTGCCGCTCCCCGGCATCTATGACCCGGACTTCATCGCTGCCAACCAGGGCTCCCGGGCTAACAATGTCATCAAGGGCACAAAGAAAGAGCAGATGGA
GCAGATTATCAAAGACATAAGGGAGTTCAAGGAGAAGAACAAGGTCGACAAGGTAGTGGTGCTTTGGACGGCAAACACTGAAAGGTACAGCAACGTCTCT
GTTGGGCTTAATGACACGATGGAGAACCTCTTGGCGTCTGTGGACAAGAACGAGGCAGAGATATCCCCATCAACACTGTATGCCATTGCCTGTGTCATGG
AGGGCGTCCCGTTCATCAACGGGAGCCCTCAGAACACCTTTGTGCCTGGGCTGATCGATCTTGCTATTAAGAACAACTGCCTGATTGGTGGCGATGATTT
CAAGAGTGGCCAGACCAAGATGAAATCTGTCTTGGTGGATTTCCTTGTTGGTGCTGGAATCAAGCCCACCTCAATTGTCAGCTACAACCATCTGGGGAAC
AACGATGGGATGAACCTATCTGCGCCGCAGACATTCCGTTCCAAGGAGATCTCCAAGAGTAACGTGGTGGATGACATGGTCTCGAGCAATGCTATCCTCT
ACGAGCCCGGGGAACATCCTGACCACGTCGTCGTGATCAAGTATGTGCCATACGTTGGAGACAGCAAGAGGGCCATGGACGAGTACACCTCGGAGATCTT
CATGGGCGGCAAGAGCACCATCGTGCTCCACAACACCTGCGAGGATTCGCTCCTCGCCGCACCGATCATTCTTGATCTGGTGCTCCTGGCCGAGCTCAGC
ACCAGGATTCAGCTGAAGGCCGAGGGAGAGGACAAGTTCCACTCCTTCCATCCGGTTGCCACCATCCTGAGCTACCTCACCAAGGCACCCCTTGTTCCTC
CTGGCACGCCGGTGGTGAACGCCCTGGCGAAGCAGAGGGCCATGCTGGAGAACATCATGAGGGCGTGCGTCGGCCTGGCGCCCGAGAACAACATGATCCT
GGAGTACAAGTGAGGAGCAGGGCCCAAGCTCGCGGGGACGAGAGCGACCGTACGTACGTAGCAAGTGGCGAGGGGCGACGGGAGGGCAGGAGGAAGAAGA
AGGCGAGATCGGCTGTGGAATTATTTGGCGGCTTGTCTTCGGTTTCCTTTGCGATTCTTTCTTTCCCTGGTTAAGTTTACCCTGGTGTGAGTGTGTGTGT
GTCCTTGCGAGACTATTTCGGCTCTCTGTCTGGCCTCTGCGACTTGGTAGATTCTCATGGACTCCATGGTGTTGGATGATGTGGAGGGAGGAGGGTGCGT
GTTAGCTAAGTTAGTCCACTCCCCTTGTTCGTGTTTTGTAAGCTAATTAGTAGTATC
page-top