Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24406  (registered. 2007)
Contig Information
Length 1055 bp
Clones 29 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 4
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 3
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown protein [Oryza sativa (japonica cultivar-group)] >gi|57863844|gb|AAW56885.1| unknown protein [Oryza sativa (japonica cultivar-group)] >gi|125592485|gb|EAZ32544.1| hypothetical protein OsJ_016027 [Oryza sativa (japonica cultivar-group)] >gi|215768079|dbj|BAH00308.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218195909|gb|EEC78336.1| hypothetical protein OsI_18077 [Oryza sativa Indica Group]
Score 447
Evalue 2.30862e-42
Total Hit Count 110
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24406
AAAAAGATGTTACATTAAATTTACTAAAAAAAACACTTGAAACACGAGGTAAACTGAATTACAAAATCAAATTTCCTAACAAGATTACAAACTATAATAC
CATAATATAGAATATAGTCTAGCAGAGTCGGAGAATACAAATCATCTTTTCTAGTTGAAATGTGTGGATTTATACATTTATTTATAAATTAATTTTTTTA
ATAACTCATAATGTAGCATCAAAAGGATTGAAAGCACCTCGTGCCGAATTCGGCACGAGGCTTGGGTGGATCTCATCTTCAGATCACATCCAAGCAGCGC
AAGCAAGAGAGGAGACGCGCTCCACCGTCGGCAACCAAACCAGGCAAAGGGCGGCGATGACGTTCGACAAGGTGGAGGAGCTCCGGCCGGGCACCTACGG
CCACAACCTCCAGCTCCGGGTGCTCAGCGCCAAGCCCGTCGTCCTCCACAGGCCGCAGGGCGGCAGGGCCGGCGGCAACATGCGCATCGCCGAGTGCATC
GTCGGCGACGACACCGGCGTAGTCGTCTTCACCGCACGCAACGAGCAAGTGGACATCATGAAGCCCGGGGCAGTCGTGGAGGCGAGGAAGGCGAGGGTGG
ACATGTACAAGGGGTCGATGCGCCTGGCGGTGGACAAGTGGGGGACGCTCAAGGCCGCCGAGAGCCCGGCCGACTTCAAGGTGAAGGAGGACAACAACGT
GTCCTTGGTCGAGTTTGAGCTCATCACCGTGATGCAGTGATTGAAGAAGGCTCCTCCTCCTCCTCGCCTATGAGGAGGAGGAGGCACAGGAGGCTCAGCA
GCTGTTAGGCTGAGCACAAAGCAATAAACCGGCCAATCATGGCTCATGTTCTTCACCCCCTCCCCCCCTCTCTCTGTTTACTGTTTATTTGCTGGAAGTT
TTGCTAGTCCTGCTACCTTGGATTAATTGTCGTTAGTAATACAATATATGTTTGTTTGTGCGGAGTTGCATCCAGATTGTTGCGAGTGAGTCCTGCCATC
TCTTTGTGTTAGACCTGGTATATCAATTAACTAATTATGTTGAGCAAAAAAAAAA
page-top