Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11955  (registered. 2012)
Contig Information
Length 1385 bp
Clones alternative view 50 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_KMP Shoot grown under continuous light 4
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 1
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VABA Shoot with ABA treatment 2
Wh_VHS Shoot with heat shock treatment 3
Wh_VWD Shoot grown with dessication 7
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 4
WH_XE Seedling, infected with leaf rust 2
WH_XF Seedling, infected with leaf rust 9
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 5
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|76363515|sp|Q43139.2|F16P2_SACHY|F16P2_SACHY RecName: Full=Fructose-1,6-bisphosphatase, cytosolic; Short=FBPase;"
Score 625
Evalue 4.00E-177
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig11955
TTTTTTTTTTCATTCCGCACAGCTTGCGGCACTGGTCCTCCTGAGATGGATATATGTATACATGGATGTATATTACGTATCATCAGTGAACGAATTGTGG
AAAGAAGCAGAAGCCTTGGCTGCTCACGAGTGAAGCTGTTCAAGGCCTCCACGCTATATTACACTGAATGACACAGACGTATATATAGAAAAGAAATGCC
TGACATTCGAATCACATTGTCAGCAAGGCCCACGAGTCGTCATCGATTCACACGCCTTGCGCGCGACGACCGGTCGACCATCATGCAGATCCTTCCTTCT
TGGCTTCCTCCGCGTACAGCGCCTTGATCTCCTCCACGTCGTCGCTGCTGCCCAGGAATATCGGGGATCTCTCGTGGATGTCGGTGGGGATCAGGTCAAG
CGACCGTCCTTTGCCTGTGAAAGACTGGCCTCCAGCCTCCTCCATCAGGAATGACATGGGGAACACCTCATACATCACACGGAGCTTTCCGCTCGGGCTC
TTCTTGTCCGCGGGGTACAGGAATATGCCGCCGTATAGCAAGGTGCGGTGGACATCGGCAACCATGCTGCCAATGTATCTCAAGGATTTGGGTGATGAAC
CATCCGTGGGATACTTGCACTTCTCCACGTACTTTGCAGTAGGGGTGTCCCAGTTCTTGGCATTCCCTTCGTTAACCGAATAGATCTTTCCTTTCGGCGG
TATCTTGATGTCTGGATGAGTCATTATGAACTCCCCAAGAGAAGGGTCAAGCGTGAAGCCGTTGACACCATTTCCAGTGCTCAGGACAAGCGTGCAGGAA
CTCCCATACATGCAGTATCCAGCAGCAATCATGTCCTTCCCAGGCTGCAGTACTTCCTCCAGAGTCACGGTGTCTTGGTTCTTGATCATGTAGATCCCAA
AGATCGTTCCGATGGAGACGCCGCAGTCGATGTTGGAGGAGCCATCCAGGGGGTCAAAGCAGACACAGTACTTCCCACGGAGCTTAGGGTCCACGAACGT
CGCCTTCTCGTCCTCCTCGGACACAAGAACACAGGTGCGGCCGCTGCTGACGAGGGCATTGACGAACACCTCGTTGGAGAGCACGTCCAGCTTCTTCTGC
TCCTCCCCCTGGACGTTGGTCTCGCCGGCGAGACCGGTGAGCTTGGCGAGGCCGGCCTTGTTGACGGCGGAGGCGACGAACTTGCAGCCGAGGACGATGT
GGGAGAGGAGGATGGTGAGGTCGCCGCGCGACTCTGGGTGCCTGCTCTGCTCGTTCAGCACGTGCCGCGTGATGGTCATCAGGTCCGTCCGGAACGTGTC
CGCCGCGTGATCCATCTTCTCCGATCGGCCGGGGACGACCCTACCCTCCCTCTCGTTCGCTTAGCTCGGACGGAGAGCTCGTTTT
page-top