Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24369  (registered. 2007)
Contig Information
Length 2340 bp
Clones 28 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 4
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_KMP Shoot grown under continuous light 2
Wh_SHC Shoot grown with cold treatment 4
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VABA Shoot with ABA treatment 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_35968 [Oryza sativa Indica Group]
Score 3016
Evalue 0
Total Hit Count 395
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24369
TTTTTTTTTTGACACCTTGCAAATGACTTTTTTTTATGTTTATTTCCAGAAGTTGAATTCATGATGAAAAGACACATGGCCAAAAAACAGTCAAAACTAT
GAGCGAGCCAGGTAGGTAAACAAACGTCGAATAGCTAGTAACAATCAATTTGGGAGTACAACTCTGCATGCATTTCCTTACGACTGAACAGCCAGCCTTT
GTAGATGCTCACAGAAGACCTGGAAGCTGACATCATCAGTGAATATGATGTCAGAACCTGGTGGAACATCATGTGCTGAATTATATGTGGCCGATGGATT
TAGTTTTGCTAACAAGAACCTTGCCTGGGAGCCATGTTGGTCACAGACAACTAGTCGAGGAACTGGAAATCGACCATTTATTATCACCTGGGCCTCCTCC
TGAGGAGCTTGTAATAATTGTGCGAATTGCTGATGCTCCGGCTGATTCTGATAACACATGTTTCTCCACTGAGCGATTGTCATTCCATGGAATATGACAA
CACTGAAGTATGCATCAAGCAGCAGTATACGATCTACTGCTATTGATGCCACATCGAGGAATACAGGAGAAGGAGGTGAATCGAAAGAAAATGAAATTAA
TGACGGCTGAATCATTGCAACTGAATTAGTGATACTCTCTCGGTTGAGTAACATTCGGAAATAGGCTGTTTCATCTGGACTGTTATTGAAAACCTGAACA
AATTGCGAACGCCGGAGATTAAACATAAACTGAGGAAACAGTGAGAAATTAGAATGTAGGCTAAATGAAGAGGGGTCATCCTTCCGATAATCCCCAAATC
TTGAACATAGTCGTATGAGAGATCTATCGAGCCACCGTGTTGCATCAAACTCTTCCTCTATTTCCATTTTCAAGGAGATGTATCTTGCCAACACAACAGC
TGCAGTTTCCTGGTCAAATCCTTCGACTAGTTCCTCAGTATTGGTAGAACCATCCACCCATTTTCTGGATACAGTAGTAGCTCTTATTCTCATTTGACCT
TCCGGGTGTTGGTAACTGGTTACAAACTGTATGTACAAATCGGGATTTTGATGACCTGGTTGGCCAGAGCGTTCACTCGGTGAGACATCAAAAAAAACTG
TAAGTGAAGTATTCCTATCAAGCCCACACATTTTCCATGCTGTTGTGTTTCCCTGACCGACAATTGTGTCTGCACATAAAGCTCCTTTCTTCTCCAAAGA
TGTACACGGTCCAATAACACCCTGAACTTTAATGTCCTTTGAACAGTTTATTTCAAATGTGCCATTGAATGACAGGCCCAATGAATGTTCACCTCCCTCG
AAAATACGTTTAAAAGAATCCTTAAACACAGAATGCCCAAAACTCTCAGATAAGACAACAAGGCCGCCTGTTCTCTCAATAGCAAGCTTCATCTCAGCTA
GTCCAACCTGATCAAGAGCAGATGCAAACACATCTAGAACATGACCTTGACTGACCAATTGTTTGGCAAGGCCATCGTAAAATTTGACGGCTTTCTGGAA
ATGAGGCGCCGCATCCTTATCAAGATCCTTGTGTGATCTAACTGGCTCAGACAAATCTTTTGATACAATCACTCCAGGACCTTCGGTACATGGCCCGCCA
AGTAGCGCAATAATCCTTGCACCAGTCCCAGGCACGCATGCCCCAAGCAACCCAGCCGCCACATTTAGCGCAACACCCGTGCACCTGATGGCACGGTTGC
CAGCCTCAACCGGCCACTGGTCAGGCTGCAACTCGTCCAGCAGCGTGCTGAGCGTGCACTCGCACTCTGATACCGGGAGCAAGAACCTGTTAACCCCTGT
CGTGACTAATGGATGCATCCCATTGACCTGTTGCACGCCTGGCTGCTGTGTCATCTTTGGGAACCCTGGCCGCCCCCCGCCTGATAACCCAAGCTGATCC
AAAATCTGCTCTTTGGAGATCTCCTTGCTCCCCCGGAACACGTAGATCTTGCTGAGCTCGGAGAACCCAAGCTCGTGCAGATGCACCTGCGTCCCGAAGG
TCACCAGGCCAACAAGTGCGTGCTCCGGCAGAAGCGCGACCGCCTTCCGCATGGACAGCTTGACGTACTCCAGTTCTTCCTCGATGACGCAGGTGTCGAT
GACGAACAGGAACACTGGCGGCAGCGGTGCAGGCGATCCCGGGGGTCCGGCAACGAGGTACTCGACGGTGGAGCATTGTGTGAAGAGCTCGGCGGGCACG
TTGTTCTCGGAGATGCCGGCGTAGTGCGGGGGGAAGTGGTTGCAGCGAGAAGCAGAGCGGGCAGATCCAGATCTTGGACGGTGAAGTCGATCACGGGCGA
AGGGGTTGAGGAGCGCGGAGCAAGGCGGCTTGCAGCGGAG
page-top