Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24347  (registered. 2007)
Contig Information
Length 874 bp
Clones 28 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 5
Wh_SHDr Shoot grown with dessication 4
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VABA Shoot with ABA treatment 4
Wh_VWD Shoot grown with dessication 14
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0589800 [Oryza sativa (japonica cultivar-group)] >gi|113532977|dbj|BAF05360.1| Os01g0589800 [Oryza sativa (japonica cultivar-group)]
Score 357
Evalue 6.51009e-44
Total Hit Count 241
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24347
TTGAGTAAATTCATGTAGTATTAACAAACAAGAAAGCTGGAAATTGGATTTTACATTCGTCAAAACTGACAGGACAGCACAAATGAAACTCAAGGATATA
ATAGTGTGCAGGATTGATCTTTCTATACATGAAAGAAGATAGATTATACTTCAGACTTATAGAAATACAGAACAACACCGCCAAACATGAGCCATCAATC
CAAATCCACAATCCCAAAATTGGAGAGAAGGATCTTCATTTGCTCAACGAAATCCGAGCCTGTTGCGTACTCTGTTAGCATCCCCACTGCAAACCCAAAC
ATAGCCCATCTTCCATTGGCAATCTCATTCTTGGCCAACCACCCAAAGAAGGGTCCCTGGTTGGTCTCCTCCAGCTTCTTCTTCTTGAAGTATTCCTGTA
GCTCCTTGGCCACCTTCCTCTGGTACTCGAACGTCACAACCCCTCCCACCGGTGGCGTCGCAGCGGCAGCCACTGCCGGTTTGGTCTCGGGAGGAGGAGG
TGATGGCTGTGCTGGCTTCACTGGGGTCGGTGGCTGGGACAGGCTCGGAGGGGTGGACAGGGCTGGCGTCTTGGGAGGCATAGGCGGGGGCGGCGACAGT
GGAGGCGCCGTGGGTCTCCTGGGCCCCTCGGCCTTGGAGCTCCTGATCACGGCGAACGACTTGCATGCCCGGTACGGAGGCGGCGGGGCGATGCGTCCCA
CCTTCACCTTGATGGAAGGGATGGAAGGTGCCAAAGACATTGCTTGGTTTGAGCTGCCTGGCGTTCTTGATTGTCTCTTGGAAGGCAGGAAGGAACAGAG
AGACGGAGGGGAAGAGAGTGAGAGGGAAGGAGGGAACGCGTGGAGAAGGTTTGGACACACACCGGCCTGGCCGT
page-top