Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24333  (registered. 2007)
Contig Information
Length 1043 bp
Clones 27 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 4
Wh_RDr Root of dessiccated seed 3
Wh_SHC Shoot grown with cold treatment 2
Wh_VABA Shoot with ABA treatment 2
Wh_VSCB Liquid cultured tissue 3
Wh_VWD Shoot grown with dessication 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0195600 [Oryza sativa (japonica cultivar-group)] >gi|75123464|sp|Q6H7P8|SAP4_ORYSJ RecName: Full=Zinc finger A20 and AN1 domain-containing stress-associated protein 4; Short=OsSAP4 >gi|49388120|dbj|BAD25251.1| putative zinc-finger protein [Oryza sativa Japonica Group] >gi|113535717|dbj|BAF08100.1| Os02g0195600 [Oryza sativa (japonica cultivar-group)] >gi|125538468|gb|EAY84863.1| hypothetical protein OsI_06227 [Oryza sativa Indica Group] >gi|125581153|gb|EAZ22084.1| hypothetical protein OsJ_005567 [Oryza sativa (japonica cultivar-group)] >gi|215692751|dbj|BAG88171.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215695215|dbj|BAG90406.1| unnamed protein product [Oryza sativa Japonica Group]
Score 733
Evalue 1.55454e-75
Total Hit Count 411
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24333
TATTTGAGAGCGGAGAGCTAACCAAGTACAATTTTCCAAACTAACAACAATGAGAACACAAACTATACAACCATAAACATAATTGACTTGGACATACTCA
AACATGGAAAATGAACCCACACGCAATATGATGAACCATTGCTGGCTACTATTACTGATCAGAATTTAACACACATGGGACAATAGTACATAACAGAGCT
AGCTAAAATGAGAAGCCACAATACTGACCGAAAAAACCACCATGAATAAAGTTACACAACACGCAAACCACAATACTGAGGATTGAGTTCTTGCAGCCGC
CACGACGCAGTGTGCATCACGATGCCGTACAATTTAGGAAATGCGGCAGCCAACAAGAAAGGGAGGTGCAAGGATGGCACAGCAAAGACGGATGATGAAC
CTTGGCAGATTGCAACCATTTCTTCCCTGTAGGACACCTAAATCTTGTCGAGCTTCTCTGCCTTCACCACCGGGTTGGCCTTGGCGATGGCATCCCTAGC
TGCAGTCCGGTAGTCGAACTGGCAGTCATGCTTGTCGGAATAGCGATGCAGTGAACAGTACATGTTACCGCATCGGCAGTTGAATCCCGTCAGCCCAACC
CTCTTCCTGCAAGTTGAGCACCGATTCGGCCCCTCCTTCCTCTTGGGGCTCACGGCAACAGCTTCGCTGGTGCCTGCAACATCAGCAGCAGGCTGCACAA
CAAGCGCCTTCACGTCAACTTGAGCAACCGCCACCTCTGCGCTCGCGGCCACAGCCGCAACAACAGGTGCTTTCCCACCATCGCCACCGTTGACGATGCT
ATCGAAGGAGGAGGCAGCCAGCTTGGCCTGCTCCTCCTTCATGACCATCTCCTTGTGGCACTTGGAGCACATGTTCATGGTCGCGGCGCTGCCAAAGAAG
CCACAGTTATTAACACATAGGATTGGGCCCTCCGGCTGCTGGCAACCCGCCTCCTTGTGTTCCATCTTGAATAACTGTAAAGCCTGTGGCGAGGCGGCGG
CGGGGCCGGAGGAGGAGGCGTGCGGGGATTGGGAATCGCGAGG
page-top