Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24323  (registered. 2007)
Contig Information
Length 1392 bp
Clones 27 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_EM Dormant seed with water absorption 6
Wh_EMC Dormant seed with cold treatment after water absorption 3
Wh_EMI Dormant seed with water absorption after breaking 6
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 4
Wh_VSCB Liquid cultured tissue 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_27561 [Oryza sativa Indica Group] >gi|125601956|gb|EAZ41281.1| hypothetical protein OsJ_024764 [Oryza sativa (japonica cultivar-group)]
Score 409
Evalue 2.58517e-67
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24323
TTTTTTTTTTAAGCTAACCAGGTTCTCTTTTCAACTCAAGAAGTTCAAAGTTAACATAACAATCTACTAGTACTACAGAGAGTAAACTTTTAGAAGGCAA
GCCTGGCGGAACATCGCAAAGATTTAAAGCAGCAGGTGACAAAACATATATAGCTTTCAAATATATCTTGCTGTCAGCAGGGCTTTGGAACAGAAGTCAG
GCAGTCCACTGCCCGCCGTATCCAGCAGCAGCAGCAGGCTGAGGTGACACGCCCTTTGCAACCGCAGGCTGTGGGTTTGCAGCAGGTGCAGCATAGCCAC
TTTGAGCTGCTGGTGGCGCAGACTGATCATAACTTGGTGGGTTTGTAGCTGGTGGCTGAGTGTATCCTGCCTGACCATATCCAGGCTGACCAGTTGTCGG
TGCAGCAGCATATCCTGACTGTGGGTAGGCATTTCCATAGTTGGGATCAGCTGGGGCTCCCTGATAACCATAGTTTGCATTGTTTTGAGCTGACTGATCA
CCGTATGCTGGCTGTGATGCAGGATACTGCGCATAGCCGCCTTGTTGACTGTACCCTGGTCCTGCCGGAGCACTCTGACCATATGCTGCTGGCCCTTGCC
CTTGCCCACCCTGCTGTGAATAACCCTGCTGAGCATACCCATCAGGTCCAGTTGGGTATGTTTGACCATAAGCAGGAGGTTGCTGGGCTGGCGGAGCATA
AGATGCAGGCGGTGGTGCCTGGTAAGCACCATCTGCAGGTGCACTGCCTCTGGGTGGCCATTGTCCAGGTCCACCATATGGAGGTCTAGCATAAGGATCT
GGCTGTTGAGGGTAGCCTTGCTGCGGACCGGCTGGTGGGCTGCCCATAGTACTGCTGGGCTGGAGCTGGAGCACTGTACCTAGGATCACCATATCCAGGG
CCATAGTTCTGTGGAGGTGCAGACTGCGGATACTGAGGCTGTCCATAGCTTGGAGCTTGTGATGGGCCATAGCTGTTGAAGTTACCTGGTCCAGGGGGGT
AGTTTGGTGGCTGGCTTTCATAAGGTTGAGATCCCTGTTTGTAGTAGTCATAACCACCACCCTGGTGAGGCGGAGGGCCCTGCCTCTGGTCCCAGCCCAT
GCCACCTCTTGGTGGTGGCTGCTGTGGGTAACCACCATAAGGGGGTTGAGAGTATGGCGCGTTCTGAGGAGGCCCTCTTGGTGGATATCCATACTGCTGA
GGTTGAGACCGTGGCCCCCACTGAGAAGCTGGGCCATGACCCTGAGGGTTGTGATGTTGCGGACCATAGCCACCAGACTGAGTTGTGTTTCTTGGAAATG
TCTAGACATGGTGATGCAGTATCCTTGGCATGGCAATGATACAATTGGTGCAGTCTTCCAATGCAGGATTGGTTTTTCTTTCCATTTCAGCC
page-top