Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24312  (registered. 2007)
Contig Information
Length 584 bp
Clones 27 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 6
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_PCDAM Anther at meiosis 4
Wh_RDr Root of dessiccated seed 4
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Zea mays]
Score 426
Evalue 2.0041e-40
Total Hit Count 37
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24312
TTTTTTTTTTCTCCACAGCCTGGAAAGTTCAAGCCACTTGTATTATTAACAGAAAAGCAGTGCCGTAAAGAAACGAGCTTACAGATTCAGATCATCTGCT
AACAGCAAATGGAGTAACACGAAACAACAAGAGTCAAGTGAAGTGACAGCTTTGGCTTCACAAAATGCTAAATTCAAAATAGGTCCAATAAGTAGGCCCT
GGGAGGGTATGTGAGCTCATCCGGAGGCTTTCTTTTGCTGGAAGATGACCGCGAAGACCGGGACACCGACACCAATGCTTACGGCTCCCAGCACTGAAGT
CCATGCAGTCAGCTTCTGATGCTTCATCCTGTGCAAGTTGTACATGTGCTTGGCGTGGAGGTAGTATGGCTCATCATGGCCGTGCCCTGACATCCTCTTC
ACGCCGGTAGCATGGAATCCACGTGAAGCTGGCTTGGAGGCCTCGGCGCCGGTGGCGAGGAGGCGGATCCCGGAGCGGAGGCCGCGGTTGAGAGCAGTCG
CCATCGCCTTCGTGCTCGTGTTCGTCTGGTCGCCGCCGCCGGAGTTGTGGTGGTGGGTGCGTTTTGGGGGTGATTTAACCGATC
page-top