Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24308  (registered. 2007)
Contig Information
Length 778 bp
Clones 27 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 6
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 4
Wh_SHDr Shoot grown with dessication 6
Wh_V483 Shoot grown under cold condition for 3days 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 624
Evalue 4.12311e-63
Total Hit Count 130
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24308
CGCGGTCGGCACCGCGCTCCGCTCCTCCTCCGTCCACCTATAAACAGGCGCGCCGCGATGTTTCCTTTGCGTGCTTCATCCATCACATCCAGATCGAAAC
TAGAAGCAGAGTAATCGAGCTAGGATTGAACAGAGGAGGGGAGGAAGAAGCTTAGGGGGTGCCGGCCATGGCGAGCCTGATGGACAAGGCCAAGGGGTTC
GTCGCCGACAAGATCGCGCACATGCCCAAGCCGGAGGCGTCGCTGGACAAGGTGACCTTCAAGGGCATGACCCGCGAGGCCATCACCGTGCACAGCCACG
TCAACGTCACCAACCCCTACTCCCACCGCATCCCCATCTGCGACATCGCCTTCAACCTCAAGTGCGGCGGCAAGGAGGTGGCGAGCGGCACGATCCCGGA
CCCGGGCTGGATCGAGGACAGCGGCGAGGTCACCAAGCTGGAGGTGCCGGCCAAGGTGCCCTACGACTTCCTCATCTCTCTCATGAAGGATCTGGGCAGG
GACTGGGACATCGACTACGAACTCCTCGTCAAGCTCACCATCGACCTCCCCATCATCGGCAACTTCACCATCCCGCTCGAAACCGCCGGCGAGTTCAAGC
TGCCCACCCTCAGCGACTTCTTCGGCGGCGCCGCCAAGACCGAGGAGGCCACCGCCTAGCCATAAGCTCGATCTAGCTCGCAGCTTGCTCTGCATCCGCA
TGCCTGTACTCTACCGTTGCCGCAATAATGAGAGCAAATATTTTCGGATTTCTTTCCGCTTTGTCTCGAAAAAAAAAA
page-top