Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24301  (registered. 2007)
Contig Information
Length 879 bp
Clones 27 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHC Shoot grown with cold treatment 11
Wh_SHDr Shoot grown with dessication 1
Wh_VABA Shoot with ABA treatment 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_35973 [Oryza sativa Indica Group]
Score 340
Evalue 4.37604e-30
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24301
TTCTTTAGCACCTTTTGTGTCAAGCTCTTTCCAGGATACCATTCAATTTCAGTTCCAATAGCCTTCTNTAGGATTGGTTCATCTTCATCGATCATGTGGT
ACGTTTTTGAAAGCACTTCATTCTTGAAGAATGGATTAGTATTGAAGTGGAACTCAAGCTTGAAACCCTCGTGCCGAATTCGGCACGAGGGCCGCCGCCT
CCTCCTTCTCCTCGGGTGCGCACAGTCGTCCACCATGGCCGAAGCAGATCCACGAGATCAAGGACTTCCTGCTGACGGCGCGCCGGAAGGACGCGCGGTC
GGTGCGGATCAAGAGGACCAAGGACGCCGTCAAGTTCAAGGTGCGCTGCTCCAGGTACCTCTACACGCTCTGCGTCTTCGACGCCGACAAGGCCAACAAG
CTCAAGCAGTCCCTCCCACCAGGTTTGAGCGTCCAGGAGGTTTAAGCATCAAGCCAGACAATGCCTTTTCTAGTAGCGGGAATGTTCTATCCATCTTGCT
TTAGTAACTGTTAGCAGGCTCTCCTTGTTTACCCCCATTAAGAGAGTTTTGATGTCCCAAGACTGGAATGTAATGTTGGGAGCTATGTGGTTGAACCTGT
GAGGATTTTTGTGTTATTTTCACTTGCTGGAGAAGGAGATCCATTATCTTATCCTAAATTGGTTTAGTATCTCACTATTTTCCTGAATGTTCTGCATTTT
CTTCAGCCATGGCCCATGGTTGGCCACTCTTAATCTTCATAACTCAAATCAATAAGATTTACCCCCTCCGTTCCCAAATGTAAGTCTTTGTAGAGATTCC
AAGCAAGTGATTATATATGAAGCAAAATGAGTGAATCTACACTTTAAAATATATCTACATATATTCAGTAAAAAAAAAA
page-top