Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24276  (registered. 2007)
Contig Information
Length 1334 bp
Clones 26 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 5
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 1
Wh_VHS Shoot with heat shock treatment 8
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit light-harvesting complex IIa protein;
Score 1085
Evalue 3.40499e-116
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24276
CTTCGGCCTCGGGAAGCCCGCGGAGTACCTGCAGTACGACGTGGACTCCCTGGACCAGAACCTGGCCCAGAACCTGGCGGGCGAGATCATCGGCACCCGG
TTCGAGGACGCCGACGTCAAGTCCACCCCGTTCCAGCCCTACGCCGAGGTGTTCGGCCTCCAGAGGTTCCGCGAGTGCGAGCTCATCCACGGCCGCTGGG
CCATGCTCGCCACCCTCGGCGCCCTCACCGTCGAGTGGCTCACCGGCGTCACCTGGCAGGACGCCGGCAAGGTGGAGCTGGTGGACGGGTCGTCGTACCT
GGGGCAGCCGCTGCCGTTCACGCTCACCACGTTGATCTGGATCGAGGTGCTGGTGATCGGGTACATCGAGTTCCAGCGCAACGCGGAGCTGGACCCGGAG
AGGAGGCTCTACCCCGGTGGCTCCTACTTCGACCCGCTGGGACTCGCGGCGGACCCGGTGAAGAAGGAGACTCTGCAGCTGGCGGAGATCAAGCACGCCC
GCCTCGCCATGGTCGCCTTCCTCGGCTTCGCCGTGCAGGCCGCCGCCACCGGCAAGGGGCCACTCAACAACTGGGCCACCCACCTCAGCGACCCGCTGCA
CACCACCATCTTCGACACCTTCGGCTCCTCTTAAGTGGTCGGTGGTCGAGCAATTTCTGTCAGCTCAGCTGCAAAATGGACGAACGCGCGTCAGTGTACG
AACGTGCTTTGGTTTTGTATGACGAGTGATGGATGAGAGGGTATCGCAAAGATCCTTTGTTGATTAATGCAGGTCTGATCACATAGGAGAGCTGCTGGGA
CTTGGTGATTTGTAAAATATGAACCAATGGTGACTTAATGCATCCACTTGTACATCAAAAAGGAAAGGAAAGGGGATCGCGGAGCAGCAGCAGCAGCCAT
GGGCGTGATGGGCAGGCTCAAGATCTTCGTCGTCAAGGAGCCCGTCGTCGCCGCCTCCTGCCTCATCGCCGGATTCGGTCTATTTCTTCCAGCGGTTGTT
AGGCCAATGTTGGATTCTTGGGAGACTGAGAAAAATGCCAAAACCCCGGTTGAACTAAAAGATGTGGTCGCAGGGGTCACTGGCAAGAAAGCTTAGTGAT
CAACGTCTCTTCACTCTGCTGATGTTGTCTACACATTTTGTTCCGCCTGTTTTTGGTGCCCAGACGAGGGGGCTCTCTTCTGGGATGTAGTCGGATCTCG
GCCAAAATAATCATTGTGTCTGAACCTATTTTTACCATAGTGCAATGAGATGGACTTGTTGTTTCAGTGATTCCAAGTTGTAAGAAAGTGAATGCATGGA
AGGCCGTTGTTACCCTTTTGATCGAAAAAAAAAA
page-top