Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24269  (registered. 2007)
Contig Information
Length 1730 bp
Clones 26 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 4
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_OKCS Seed DPA5 6
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 2
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VABA Shoot with ABA treatment 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative AdoMet synthase 1 [Hordeum vulgare subsp. vulgare]
Score 1153
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24269
CTGCTTGAGTTGGGCTTACATTTACCAATTGCATAAACCATGATTAAAAACCTTGAACAATATATAAAGTACAGTACTGCTTAGAAGAATGACAATTTGG
GAACAATAGGGCAATAGAATTACACATGGCTCTTTAAACTCTGGAAGAAAGAGCATTATGAGGAGAGCATTATGAGGGGAAACTACACAAAACAGAATAT
GAAAAGTGAAAGTGACGAAGTGACAGAGCAAATTGCACATCACTCAGCAGTTTCAGCAGACTCAAAAAGAAAAGGAAAAATATATGAAATGATACACCAG
TAAGAAAACTTAGCACTGATCACTAGACGGCACGACCAGTGTAGCACGTCGCGGTGATGTCGAATGCTTCTTCTTACTTCCCAGGAGCAAAAGGATCCCG
CCTTTGTCGAACTTGAGAGGCAGCAGACCAAGAATAACCCCAATGTGATGTCTTGTTCTTAGGCAGATGCCTTGTCGAACTTGAGGGGCTTCACCACCTC
CCAGGTGAAGTCGGCATCATCGCGGCCAAAGTGACCGTAAGCAGCGGTCTTGATGAACCTGTTTCCACCTTTCTTCAAGTCCAGGTTGATGCTGATCATC
CCGGGCCTGAAGTCAAAGTTCTCCTTCACGAGCTTGAGGATCTCCCTGTCGGGGATCTTGCCGGTGCCGTAGGAGTCGACGAACACAGACAAAGGCTCAG
GCACACCGATGGCGTATGAGATCTGCACAATGCAGCGGCGTGCGAGGCCGCTGGCGATGATGCTCTTGGCGGCCTGCCTGGCAATGTAGGCGCCACTACG
GTCGACCTTGGTTGGGTCCTTGCCAGAGAAGGCACCGCCGCCGTGGGCTCCCCAGCCACCATAGGTGTCGATGATGATCTTGCGGCCGGTGAGACCGGCG
TCACCGTGGGGGCCGCCGATGACGAAGCGGCCAGACGGGTTCAGGTGGAAGATGGTGTTCTCATCGAGGTACTTTGCGGGGATCACCGGCTTGATGACAT
GCTCCTTGAGGTCCGCAGCAATCTCGTCGTTGGTGACGGTCTCGTCGTGCTGGGTGGAGATGAGGACGGTGTGCACACGAACAGGTACCATGGCACCATC
CTCGTTTAGGTACTCAATGGTGACCTGGGTCTTTCCGTCAGGCCTGAGCCAGGCGCAGGTGCCATTCTTGCGGACCCTCGGTAAGGCGAGCTCCAAGCTT
GGTGGCGAGCATGTGGGTGAGGGGCATCAGCTCAGGAGTCTCATCGGTGGCGTAGCCGAACATGATGCCCTGGTCACCGGCACCGATCTCTTCGGGGCGC
TTGGTGAAGTGTCCGTGAACACCCTGGGCAATGTCAGGGGATTGCTGCTCGATGTTGACAAGCACCTTGCAATGGTCAGCATCGAGACCGACGTCGTCAG
AGATGAAGCCGATGTTGCGGCAGGTGTCGCGGACGATCTTCTCGTAGTCGACGGTGGCCTTGGTGGTGATCTCGCCAAAGACCATGACCATGTTGGTCTT
GGTGCAGGTCTCGCAGGCAACCTTGCTGTCGGGATCCTGGGCCAGGCAGGCGTCCAAGACGGCGTCAGAGACCTGGTCGCACAGCTTGTCGGGATGGCCC
TCGTTCACGGACTCGGACGTGAAGAGGAACGTCTCAGCCGCCATTTCTTCCGTGCTAGCGATGCTCTTGTGCAGTTGTGCTGATGCTATTCTTCAGGAGG
CCGAAGAACCGAAAGGAAGAGGTCGCCTCG
page-top