Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24267  (registered. 2007)
Contig Information
Length 978 bp
Clones 26 Clones [Download: TSV  ,  FASTA ]
Wh_V4816 Shoot grown under cold condition for 16days 5
Wh_V483 Shoot grown under cold condition for 3days 7
Wh_VHS Shoot with heat shock treatment 4
Wh_VWD Shoot grown with dessication 10
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Unknown (protein for IMAGE:5194336) [Homo sapiens] >gi|111494016|gb|AAI11385.1| Unknown (protein for IMAGE:5198300) [Homo sapiens]
Score 1340
Evalue 5.78736e-146
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24267
TCCTCATTCTTGGAGAACAGAATACAGAATACGTAGGACCTCCATCGATCAGAATGGCCGCAACCACCATGTCACTCTCTTCTCCAGCCTTTGCCGGCAA
GGCAGTGAAGAACTTGCCATCATCTTCTCTTTTCGGGGATGCCCGCGTCACCATGCGCAAGACAGCGGCAAAGGCCAAGCAGGTTGCCTCTGGCAGCCCG
TGGTATGGCTCTGACCGCGTGCTCTACCTCGGCCCACTTTCTGGTGAGCCCCCGAGCTACCTCACTGGTGAGTTCCCTGGCGACTACGGCTGGGACACCG
CTGGGCTGTCGGCCGATCCCGAGACCTTTGCCAAGAACCGTGAGCTGGAGGTGATCCACTGCCGTTGGGCCATGCTTGGCGCACTCGGTTGTGTCTTCCC
CGAGCTGCTTGCCCGCAACGGTGTGAAGTTCGGCGAGGCTGTTTGGTTCAAGGCCGGTTCCCAGATCTTCAGCGAGGGCGGCCTCGACTACCTCGGCAAC
CCAAGCCTTGTGCACGCCCAGAGTATCCTTGCCATCTGGGCTTGTCAGGTTGTGCTCATGGGCGCTGTCGAGGGCTACCGCATTGCCGGTGGACCGCTCG
GTGAGATTGTTGACCCGCTCTACCCGGGCAGTAGCTTCGACCCACTCGGCCTTGCCGACGACCCTGAGGCATTCGCCGAGCTCAAGGTTAAGGAGATCAA
GAATGGTCGCCTTGCCATGTTCTCCATGTTTGGTTTTTTTGTGCAAGCCATCGTCACCGGTAAGGGTCCACTCGAAAACCTCGCTGACCACCTCACCGAC
CCCGTCAACAACAACGCTTGGGCATTTGCCACCAACTTCGTTCCCGGCAAGTAAGGTGTGTGTGCGCGCACGCTTGCGGTGAAGTGTTTTGTTAGCTGTT
TGAGTTGTACTACCATGATGTAAATTACGAGGATTTGATTATCTGAAAAAATTGTGAGGTTTCTGTGCAAAAAAAAAA
page-top