Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24262  (registered. 2007)
Contig Information
Length 675 bp
Clones 26 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 5
Wh_EMI Dormant seed with water absorption after breaking 9
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 1
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os07g0674200 [Oryza sativa (japonica cultivar-group)] >gi|34393853|dbj|BAC83533.1| putative 60S ribosomal protein L22 [Oryza sativa Japonica Group] >gi|34395084|dbj|BAC84770.1| putative 60S ribosomal protein L22 [Oryza sativa Japonica Group] >gi|113612149|dbj|BAF22527.1| Os07g0674200 [Oryza sativa (japonica cultivar-group)] >gi|125559577|gb|EAZ05113.1| hypothetical protein OsI_27305 [Oryza sativa Indica Group] >gi|125601487|gb|EAZ41063.1| hypothetical protein OsJ_024546 [Oryza sativa (japonica cultivar-group)] >gi|215764943|dbj|BAG86640.1| unnamed protein product [Oryza sativa Japonica Group]
Score 467
Evalue 4.98018e-45
Total Hit Count 261
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24262
TTTTTTTTTTCAGGTGAAAACTGGAACAAATCTCCATAATATTTGTCTATAGGTTCAGACATATGGACCCACAGTCAAGGGGAGGCAAAATATAAGGATT
CTTCAAATTAAACCATTCATGTTCAACAGAGCACAACATAAGATAGGTGGATAACTAGGAGGTACTCAGATCAAGTATCAAAACTCAACAAGCACTACAA
TATAACAATGCACTCTAATCCTCCTCCTCGCCCTCGTTCTCAGCGATGTTGAAGTACCGGAGCTCGTACACGTTGCGCTCCTTGTTGGCTGCGATCACAC
GAAGCCAGTCCCGCACGTTGTGCTTCTTCAAGTACTTCTTTGTCAAGTACTTGAGGTACCTCTTGGAGAAGGCGCCGTCGGAGGTGACGGTGACCTTGCT
CTTGTCGCGCGTGACGGTGACGGAGTCGCCGAGATTCCCGGCCTTGCCGCCGGCGACCTTGATGCGCTCCTGGAGGAACTTCTCCAGCGACGCGATCTCC
ATGATCTTGTCCTCCACGGGCTTGGTGCAGTCGATCACGAAGGAGACGGACCCCTTCTTCTTGCCCTTGGCAGCCGCCGCCGCCGTCGCCGCCGTGCCGC
GAGCCATCTCACCTTCCTCTTCCTCCTCGGCCGGTGCTCGCTCGGGTTGGGTGGGGGGTTCGTGTGGCGGCGCGC
page-top