Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24261  (registered. 2007)
Contig Information
Length 830 bp
Clones 26 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 4
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_KMP Shoot grown under continuous light 2
Wh_RDr Root of dessiccated seed 8
Wh_SHC Shoot grown with cold treatment 4
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative glycine-rich RNA-binding protein 2 [Bambusa oldhamii]
Score 346
Evalue 8.01828e-31
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24261
CCCCCCTCCCACGCCGTCTCGTCCCAGCTCGCCCTCCAGAGGTTTTAGTCTTCCTCCATGGCGGCCCTCATCAAGCTCGGAAGCCTTCTTAGGCAGAGTG
CTTTGGCGAGCAGTGCCTCGACCGGCTCGGCTCCTGCCCTGTTCAACGCTGCCCGCTTCATGTGCGCCGGCCAGCCAGCTGGTGGCAATAAGCTTTTCGT
CGGCGGTCTGGCCTGGGCTACTGACGATCATTCGCTGAAGGAGGCGTTCCAAAGCTTTGGAGAGGTCGTTGAGGCACGTGTCATCACTGATCGAGAGACT
GGAAGGTCTAGAGGGTTTGGTTTTGTGAGCTTTGCGAATGAAGCTGATGCAGATAGCGCTGCAAAAGGCATGGACGGTCAGGAGCTTGCAGGGAGGAACG
TCCGTGTGAACTTCGCCAATGAGAGACCTTCGGGTGGTGGCGGCTTCTCACGCGGCGGCGGTGGCTATGGAGGAGGTGGTGGCTTTGGCGGCGGCGGCGG
CTACGGCGGTGGTGGCCGAGGTGGCGGTGGCTATGGTGGTGACCGTGAAGCTTTCTAAGGAGAGCGCAGACTATCAAATTTAAAATAATGCGCTTTTAGG
ACAGTGTCTTGATTATGTGGAACCTATGTCACGTCTGTCTGTTATCTGCGATAGTTGAACTCAATAGGGGCAGAGATGTGGTTCTAGTATTTTTGTTTTT
GGTTCGTTTCTTGATGGTGCAAGAGTTTAAGTCATGCTGCTTCGAGGCTTGGATGAGTCTCAATGGAAGTTCATGCATTTTGCCGTATATTGCACTGTGT
ACTTGTGGTGAGTCTCTGAGTTAAGTCGTG
page-top