Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24257  (registered. 2007)
Contig Information
Length 2127 bp
Clones 26 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 3
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_PCDAM Anther at meiosis 10
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 1
Wh_VSCB Liquid cultured tissue 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit calcium-dependent protein kinase [Zea mays] >gi|1330254|dbj|BAA12715.1| calcium-dependent protein kinase [Zea mays]
Score 989
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24257
CCGAGATTTCATTCTTGCCCGTGTGTATTAGTCGCTCTCACGATTGGGGGCGACGCTAATCGCGGTGCCACCACTTCCAATCCACTCTCGGTCTCTCGCG
GTCGCCGTGCCGAGCTGTTCCTGCTCTGTCTTCAACTACTCCAAGATTTGTTCTTTAGACGCCTGCAGCTTCGGTGCGCAGGGACGGCGGAGAGCTCGGG
ACTTGGTTCAGAGCTTAGGATCTTTGTCGATTCAGGTTTCGATTGGTTTCGTCTGCTCGGCTGACTGGGTTGTAAATTTGGAACTGAAAGGAAGAATTTG
AGCACAGATGGGCCAGTGTTGCAGCAGAGCTACGTCCCCGGATTCTGTCCAAGGAGGAGCCAATGGCTATGGCTATTCTCACCAGCCAAAACAAGCACAA
GCACCTCCTAGTTACAACAATGCTCAGCCACCACCACAAGCTGAGGTGAGGTACACACCGCCAGCGATGAACCCTCCTGTAGTCCCACCTGTGGTTGCCC
CCTCAAAGCCCATGCCGGACACGATTCTCGGCAAGCAGTACGAGGATGTGCGCTCTGTCTACTCCCTTGGCAAGGAACTTGGTAGGGGGCAGTTCGGGGT
GACGTACCTTTGCACTGAGATTAGCACTGGCAGGCAGTATGCTTGCAAGTCCATATCCAAGCGCAAGCTCGTGAGTAAGGCTGACAAGGAGGATATCCGC
AGGGAGATCCAGATCATGCAGCACCTATCTGGGCAGCCAAACATAGTGGAGTTCTGTGGAGCATATGAGGACAAGGGCAGCGTGCATGTCGTGATGGAGC
TCTGTGCAGGCGGGGAGCTGTTTGATCGGATTATTGCCAAGGGGGCACTACTCAGAGCGTGCAGCTGCTACAATCTGCAGAGGAGTTGTGAATGTTGTCA
ATGTTTGCCATTTCATGGGAGTGATGCACCGCGATCTGAAGCCGGAGAACTTCTTGCTTGCGACCAAGGATGAGAATGCAGTGCTCAAGGCCACTGATTT
CGGGCTTTCGGTCTTCATTGAAGAAGGAAAAATGTATAGGGACATCGTTGGAAGTGCTTATTATGTTGCTCCTGAAGTCCTTAGGAGAAACTATGGTAAA
GAGATAGATGTTTGGAGTGCAGGTGTTATTCTGTACATTCTTCTCAGCGGTGTTCCTCCATTCTGGGCTGAAACTGAGAAGGGAATATTTGATGCTATTC
TTCAAGGGGAGATTGACTTTGAAAGTCAGCCATGGCCCATCAATTTCTGAGAGCGCTAAAGACCTTGTGAGGAAGATGTTGGCACAGGATCCAAAGAAAA
GAATTAGTTCAGCCCAAGTTCTTCAACATCCATGGCTCAGGGAAGGAGAAGCATCAGATAAACCTATTGACAGTGCTGTTCTTTCTAGGATGAAGCAATT
CAGAGCAATGAATAAACTGAAAAAGATGGCTCTAAAGGTTATAGCTTCAAATCTTAATGAGGAAGAGATCAAGGGCCTGAAGCAAATGTTTATGAACATG
GACACAGACAACAGTGGGACAATCACATATGAGGAACTCAAAGCAGGACTAGCCAAACTTGGATCGAAGCTCTCAGAAGCTGAAGTAAAGCAGTTGATGG
ATGCGGCTGATGTGGATGGCAATGGATCAATTGACTACGTTGAGTTCATAACAGCAACCATGCATAGACACAAGCTCGAAAGAGACGAGCATTTGTTCAA
GGCGTTCCAGTACTTTGACAAAGACAACAGTGGCTTCATCACAAGAGATGAACTGGAGACTGCTTTGATTGAGCATGAAATGGGCGATGCGGATACCATA
AAGGACATCATATCAGAAGTCGACACAGATAATGATGGGAGGATTAACTACGAGGAATTCTGCGCTATGATGAGAGGAGGGATGCAGCAGCCAATAAGGC
TCAAGTAGTCTTTCCTTAGAAATGGTGTACCATTAGCAACTGTTCTTGGTTCCTTTTTTCGCTGCTGCACGGATGAGAAGTTCTCTTTGGCGTTGTTGAG
ATGATTGTGTATATCTTGTGGCCTTTTGCTCGTGCATGTTGTTCCTCTAGTGTTTTGGACCTACTTTCTTCTGCAAGCTGGTTTTTGCAAGTACATCTAA
TAAAAGAGTATTTTTGCAAAAAAAAAA
page-top