Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24236  (registered. 2007)
Contig Information
Length 768 bp
Clones 26 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 4
Wh_KMP Shoot grown under continuous light 6
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 5
Wh_OKCS Seed DPA5 6
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Histone H2A.2.1
Score 459
Evalue 5.50959e-44
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24236
TTTTTTTTTTAACAAACACTGCATTAGAAACCAGATTGATATAGCAGAACAGAGGAAGCAAGACGCTTCCTCTTCGTTTCACGGTTACATGGCGGGGCAA
AGCAAAAGAACAAGCTTCAACACACTCTGGAACACACCACAGCTAACTTAACACAGAGACACTAGGCACACGAGGGCTGACGGAGCACCATCAGTCCAGT
TCACCGGCACGGGCGCTCGGAGCCAGATCTACGCCTTGGTGGCCTTCTTGGGGGACTTGGTGGCCTTCTTGGGCGACTTGGTGGCGGTCTTCTCGGCCTT
CTCAGCCTTCTCGGCGGCCTTCTTGGGGAGCAGCACCGGGTTGATGTTGGGGATGACGCCGCCGTGGGCGATGGTGACGCCGGACAGCAGCCTCCCGAGC
TCCTGGTCGTTGCGGATGGCCAGCAGCAGGTGCCTGGGCACGATGCGGCTCTTCTTGTTGTCCTTGGCGGCGTTCCCGGCCAGCTCCAGCACCTCTGCTG
CGAGGTACTCGAGGACGGCGGCGAGGTAGACGGGGGCGCCGGAGCCGACGCGCTGGGCGTAGCGGCCCTTCTTGAGGTAGCGCCCGATGCGGCCGACGGG
GAACTGGAGCCCGGCCTTGATGGACTTGGTCACCGACTTCTTCCTCGGCCCGCCGAACTTCTTCGCCGCCACCTTCTTCGCCTTGCTGCCGTCCATCTTG
CTTGCTGGCGGGTTGCTGGGGCTCCGGCGAGAGGGTTTGGGAGTGGGTGGGAGCTGAGCTGTGGTGCG
page-top