Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24218  (registered. 2007)
Contig Information
Length 518 bp
Clones 25 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 4
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_VSCB Liquid cultured tissue 17
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Zea mays]
Score 186
Evalue 9.77342e-13
Total Hit Count 27
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24218
TTTTTTTTTTCCCCAATTCAGAAATAAGCGCAGTACAAATGTTTGCAATTCAGTAAACTACATCATGGGTATATACAAGTGACGAATCAATACTGAAATT
GACTCAGGGGAGGAGGAGTGGGGATACAGGTAAAACTCCTCCAAATTAACTCCATTTCAGAAAGAAGGAGATGACTAATTAAGCAGAGAATAAGCCGTCA
AAGGCTGCCATGGCGACCGGTGCCTTCGGCTCGGCGACGTCCGCCTTGACGAGCAGCGCGACGCGCACCTTGACCCCCGACGCCCAGGAGCCCCACACCT
TGGCCACGGCCCCGAAGTTCTCCCGTCCTTTGGACGCCTCCTCGCCGGCGCCGGCGAAGGGCGCCCCTCGCTGCAGCCTCTTCTCGAACGCCTCGTCGGC
CACCAGCATCGCTATGTCCGCCATTGGCAAGCGACCGAAAAACCACTCGAACCAGATGGAAACTGAAACTGAACCTGCTGTTGCTCTGGAATGGATGAGA
GAGAGAACTAGTCTCGAG
page-top