Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24211  (registered. 2007)
Contig Information
Length 418 bp
Clones 25 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 4
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 6
Wh_MS Seed DPA5 of DT3DL CS wheat 7
Wh_OKCS Seed DPA5 2
Wh_SHC Shoot grown with cold treatment 2
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_V483 Shoot grown under cold condition for 3days 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit HvB12D [Hordeum vulgare subsp. vulgare] >gi|3445292|emb|CAA70936.1| B12Dg1 [Hordeum vulgare subsp. vulgare] (no hit)
Score 453
Evalue 1.26397e-43
Total Hit Count 0
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24211
TTTTTTTTTTCACAAAAAAGATGAGACGCCGCAAAATTAATAGGTGCATAAAATTCAGTCACAAACACATATAATCCCCACATTACATAAAACTCTGTCT
TGGAACATAACCAGACTAGAATTAAACAGCTAAATTGGACATAACACAGGTTAAACAGCTTCCACAGCCATAGCAGCAAACACGCCAGGAATCACTAGAC
CATGCCGTCATCCCTCGGTGCCTGGCAGCCTGGATGTAGGATGATGCTTCCGCTGCTCCAAGGCGCCTACTTGGATCGCTGCCTCATCTTTCGGCGCTTC
CTCTTGAGCCTCCTCATCCTCTTCTTCTTCCACTTGGCCCTCATCGCGGCGGCGGAGTCGGCCTCGCTCTCCTTTTCGCGTCGTCGGCGGCGGCGGCGGA
AGTGTGTGGACGAACCCG
page-top