Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24209  (registered. 2007)
Contig Information
Length 1143 bp
Clones 25 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 4
Wh_SHDr Shoot grown with dessication 2
Wh_VHS Shoot with heat shock treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0646500 [Oryza sativa (japonica cultivar-group)] >gi|51535416|dbj|BAD37315.1| putative ATP synthase delta chain [Oryza sativa Japonica Group] >gi|51535638|dbj|BAD37612.1| putative ATP synthase delta chain [Oryza sativa Japonica Group] >gi|113596239|dbj|BAF20113.1| Os06g0646500 [Oryza sativa (japonica cultivar-group)] >gi|125556268|gb|EAZ01874.1| hypothetical protein OsI_23896 [Oryza sativa Indica Group] >gi|125598035|gb|EAZ37815.1| hypothetical protein OsJ_021298 [Oryza sativa (japonica cultivar-group)] >gi|215700976|dbj|BAG92400.1| unnamed protein product [Oryza sativa Japonica Group]
Score 687
Evalue 3.84449e-70
Total Hit Count 444
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24209
TTTTTTTTTTGCAGCGAAATGTACTGTCATCATATTATTTCACAATTCATACTCACTGAATACGAGTAAAAGAGAGCACTTCAAACAAAAATTACAAACA
CTTGAATTAAAAACTTTCCATGACCTCTCTTCATGTTTTTATCCATGTTTTTGGTAGAAAGGAAATTAAAGATTGTTCAGCAGGCTTCTTCCTAACCCAC
AAGACAAAATAAAACAGAGTGATGTTCTCTTGTAAAGGAAAGCTTTTATTTCAAGACCACATCGAAGAAGCAGGCATGAGGGAACCTTCAGCGGCGCAAC
CACTGCACTCTGGTGTTGATTTGGATCCAAAAGGCAGTTAGATGTCAAAGGGTTGCCTCAAGAATGCCTCCATTTGCTTCGCCCTAGTCCTGATCGACAT
GTCAAACACCTTCTGCCCAAATTCAATCACCAGTCCTCCCATGATACCCTGGTCAATCTTTTGTTCAACCAAGATGGTTTTGTCTTTCCCAAGGATATCA
CGCAAGGTCTCCTTAAGTTCTTTCTCCTCCTTCTCAGGAAGTGGAACAACAGTCCTGACAACAACTTTCACCTCCCCCCTATGTGCCATGGTCAAATCAA
CAAATCTCTCAGCAATGCGTTCAACATATTTCAGTCTTCCATTGGATGCCAATGCAGACAAGAATTTCTTTGTGATGTCAGTAAACCCGGCTTCAGAGAA
TATTTCAGTTATAGCCTTCACCCTGGTTTCTTTAGGCACTGATGTGTCCTTCATGAATTGAGAAAACATAGGGCTCTTCTTGGATGCCCCTACAACATCG
AGAATCTCAGATTCAACTTTTTCCAACGAATTTGCGTTGGCTGCTGCAAGGAACAACGCACTAGCATAGTTGCCGGTGCCACCATACAGAGCTTTTGGAA
CCTTGATCTTGTTCTCCTTAGGCTTATCCGTCTGCGTTGCCAACCCCCTCGACGCCTGAGCGACGGCCGCGGATTCGGTGGCCGCGAGGCGGGCTTGGAG
GAGCGGGACGCCGGATCTGAGGTGCCGCGCCGCCATTTCCGGTTCGTTCCGCGGTGGTGGAGAGCGAAACCTAGGAGGAGATCGGGTCGGGTGGGAGGAG
GAAGAGACGAGGCTGCGGGTCTCGTAGAATGCGATGAAAAAGG
page-top