Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24204  (registered. 2007)
Contig Information
Length 498 bp
Clones 25 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_SHC Shoot grown with cold treatment 2
Wh_V4816 Shoot grown under cold condition for 16days 5
Wh_V483 Shoot grown under cold condition for 3days 5
Wh_VABA Shoot with ABA treatment 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit metallothioneine type2 [Hordeum vulgare subsp. vulgare]
Score 78
Evalue 2.92745
Total Hit Count 1
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24204
GAAGGACAAAAGAAGCCAACACCAATCAAGGCCTCCATCCAATCCCAAGCAACCTCGAAGATGTCTTGCTGCGGAGGAAGCTGCGGCTGCGGCAGCGCCT
GCAAGTGCGGCAACGGCTGCGGCGGCTGCAACATGTACCCTGAGGTCGAGGCCGCCGGCGCCACCCTCCTCGTCGCCGCCACCGCCACCCACAAGGCGAG
CTCCGGCAGGATGGAGATGGCAGCGGAGAACGGCGGCTGCGGCTGCACCCAGTGCAAGTGCGGCACCAGCTGCGGCTGCTCCTGCTGCAGCTGCTAGATC
ATCGGTCATGCATGCACCGCGTGCCTCATATCTATGATCTATCTATATATCCATCTACCACCATGTAACGCTACCTGATCACGGTCTTTGTATGTATGTA
CGCACCTGCCTGCATGAGCAGAGCAGGTGCCATGCCATGCATGTAAACCCCTAAATAAAATCTCTCGTGGTTTAACCCCTTAAAAAATAAAAAAAAAA
page-top