Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24198  (registered. 2007)
Contig Information
Length 671 bp
Clones 25 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 11
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 12
Wh_PCDAM Anther at meiosis 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gibberellin-regulated protein 2 precursor [Zea mays]
Score 380
Evalue 6.03708e-35
Total Hit Count 219
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24198
CTGCAGCCCCCTAGTCTCAAGCTCACACCAACCAGCAGGGCTCTGCGTGAGCCAAGCAACTCAAGAACACCACGATGAAGAAGCTTCGCACCACCACCGC
CACCACCACTCTGGCTCTCCTTCTCCTCCTCGTCCTCCTAGCAGCCACGTCCCTCCGTGTCGCCATGGCTGGGTCAGCGTTCTGCGACGGCAAGTGCGGG
GTGAGGTGCTCCAAGGCGAGCCGGCACGACGACTGCCTCAAGTACTGCGGGATATGCTGCGCCGAGTGCAACTGCGTGCCGTCGGGGACCGCCGGCAACA
AGGACGAGTGCCCTTGCTACCGCGACAAGACCACCGGACACGGCGCGCGCACGAGGCCCAAGTGCCCATGATCGATCCACCACCCATGGCGTCTACATGG
TGATGGGGATAATACCTACCTGAACTGGAAGAATCCCTATCATGTACTGTACTTAGTACCATGTCGCGGATCACTACTATATTATACGGAGTATGCGTGT
AAATCATGATCTGAAGCAGGGCTCTGTGTAAATCATGATCGATCCGACTGCATGTTGATAATGCATAATGCTGGCCTAGCTGGTATGCCGGTAAAAATGT
CATGAGCAAATGTCATTGTAATGTAAAACAAACTATCACGCATTAGTAGAGTGTGTCCAGTAAAAAAAAAA
page-top