Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24171  (registered. 2007)
Contig Information
Length 2861 bp
Clones 25 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 3
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 1
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 5
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VHS Shoot with heat shock treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0519900 [Oryza sativa (japonica cultivar-group)] >gi|49387779|dbj|BAD26337.1| putative elongation factor 2 [Oryza sativa Japonica Group] >gi|113536503|dbj|BAF08886.1| Os02g0519900 [Oryza sativa (japonica cultivar-group)] >gi|119395216|gb|ABL74569.1| elongation factor 2 [Oryza sativa (japonica cultivar-group)] >gi|125539668|gb|EAY86063.1| hypothetical protein OsI_07431 [Oryza sativa Indica Group] >gi|125582310|gb|EAZ23241.1| hypothetical protein OsJ_006724 [Oryza sativa (japonica cultivar-group)]
Score 2991
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24171
GCCGCCGCTTCCTCATCTCTCACCTCTCGGCTCGGGAGACCGAAGCGAAACCCCAAGGAACTATAGTCCCAGTGTGACATTCAAAAGCAGTCAAGATGGT
GAAGTTCACAGCGGAGGAGCTCCGTGGAATTATGGATAAAAAGAATAATATTCGCAACATGTCTGTTATTGCTCATGTTGACCACGGCAAGTCTACGCTT
ACGGATTCCCTTGTGGCAGCTGCTGGGATTATCGCCCAGGAAGTTGCTGGTGATGTTCGCATGACTGATACCCGTGCAGATGAGGCAGAACGTGGTATTA
CAATCAAATCCACGGGTATCTCCCTTTTCTATCAGATGACTCCTGAATCACTTGAGATGTACAAGGGCGACAGGGATGGTGATGAGTACCTTATCAACCT
TATTGATTCACCTGGCCACGTTGACTTCTCTTCGGAAGTGACAGCTGCTCTTCGTATCACTGATGGTGCTTTGGTGGTGGTTGACTGTATTGAGGGTGTC
TGTGTGCAGACCGAAACTGTGCTGCGCCAAGCTCTTGGTGAGAGGATTAGGCCTGTCCTCACCGTGAACAAGATGGACAGATGCTTCCTTGAGCTTCAAG
TGGAAGGTGAGGAAGCATACCAGACTTTCTCCCGTGTCATTGAAAATGCCAATGTCATCATGGCAACATATGAAGATGTGCTGCTTGGTGATGTCCAAGT
GTACCCGGAGAAGGGGACTGTTGCATTCTCTGCTGGTTTGCATGGGTGGGCTTTCACCCTTACAAACTTCGCCAAGATGTATGCCCTCCAAGTTTGGAGT
TGATGAGGCAAAGATGATGGAGAGGCTGTGGGGTGAGAACTTCTTTGACCCAGCCACAAAGAAATGGACCTCCAAGAACACTGGGACAGCTACCTGCAAG
AGAGGTTTCGTTCAGTTCTGCTATGAGCCAATCAAGCAAATCATAGCAACCTGCATGAATGACCAGAAGGATAAGTTGTGGCCTATGTTGAAGAAGCTTG
GTGTGACCATGAAGAACGATGAGAAGGACTTGATGGGCAAGGCTCTCATGAAGCGTGTGATGCAAACTTGGCTGCCTGCCAGTCGTGCTCTGCTTGAGAT
GATGATATTTCATCTCCCTTCTCCTTCAAAGGCACAGAGGTATCGTGTGGAGAACTTATACGAGGGCCCCCTTGATGATATATATGCTAATGCTATCAGA
AACTGTGACCCTGATGGTCCTCTTATGCTGTATGTCTCCAAGATGATCCCAGCATCTGACAAGGGTAGATTCTTTGCCTTTGGACGTGTTTTCGCTGGGA
GGGTTGCCACTGGCATGAAGGTCCGTATCATGGGACCTAACTTTGTTCCTGGCCAGAAGAAGGATCTGTATGTGAAGAGTGTCCAGCGTACTGTTATCTG
GATGGGAAAGAAGCAAGAGTCTGTTGAGGATGTTCCCTGTGGTAACACTGTTGCTTTGGTTGGTTTGGATCAGTTCATCACCAAGAATGCAACCCTGACA
AATGAGAAGGAAGTTGATGCCTGCCCAATCAGGGCAATGAAGTTCTCTGTGTCCCCTGTTGTGCGTGTTGCTGTTCAGTGCAAGGTGGCTTCTGATCTTC
CTAAGCTTGTTGAGGGTTTGAAGCGTCTGGCCAAGTCTGACCCTATGGTTCTCTGTACCATTGAAGAGTCTGGTGAGCATATCATTGCTGGAGCTGGAGA
GCTTCACCTTGAAATCTGTCTGAAGGATCTGCAGGATGACTTCATGGGTGGTGCTGAAATTATTGTTTCCCCTCCTGTTGTCTCCTTCCGTGAGACTGTT
CTGGAGAAGTCCTGCCGTACCGTTATGAGCAAGTCCCCCAACAAGCACAACCGTCTTTACATGGAAGCTCGCCCGTTGGAGGAGGGATTGGCTGAGGCTA
TCGATGATGGCCGCATTGGCCCGCGTGATGATCCTAAGGTGCGCTCCAAGATCCTGTCTGAGGAGTTTGGGTGGGACAAGGATCTCGCCAAGAAGATTTG
GTGCTTTGGACCTGAGACGACTGGCCCCAACATGGTTGTTGACATGTGTAAGGGAGTGCAGTATCTGAATGAAATCAAGGACTCTGTTGTGGCTGGGTTC
CAGTGGGCATCAAAAGAAGGAGCATTGTGTGAGGAGAACATGCGTGGTATCTGCTATGAGGTCTGTGATGTTGTTCTCCACACTGATGCTATTCACAGGG
GTGGTGGTCAGGTTATCCCAACGGCGAGGAGGGTCATTTACGCTTCTCAGCTCACTGCCAAGCCAAGGCTGCTGGAGCCCGTGTACCTGGTTGAGATCCA
GGCCCCGGAGAACGCACTTGGTGGTATCTATGGTGTGCTGAATCAGAAGAGAGGCCACGTGTTCGAGGAGATGCAGAGGCAAGGTACCCCACTCTACAAC
ATCAAGGCCTACCTGCCTGTTATCGAGTCCTTCGGGTTCTCGAGCACCCTGAGGGCCGCGACGTCCGGCCAGGCCTTCCCCCAGTGTGTGTTTGACCACT
GGGACGTCATGGCCTCCGATCCTTTGGACCCTGGCACCCAGTCGGCGACGCTCGTGACGGAGATCCGCAAGAGGAAGGGTCTCAAGGAGCAGATGACCCC
CCTATCCGACTTCGAGGACAAGCTCTAAATTTTGGGGCTTCGAGGACAAGCTCTAAATTTTGGGGCCATGTTTTGGTACTGGCTCTTGCTGTGAAGGGAG
GCGCGGTATTTTTCTCCCTATGTGTCTTCCTTACTATGTTGTTGTTTGTATGTGGTGCTACTGAGACTATGGTTTTGATGATGGTTGTGGTGATGTAACA
GATGTTAAACTTAGATCATACATTTCTGGCATCCCATGGTGGTTTATTTTTAAAAAAAAAA
page-top