Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24165  (registered. 2007)
Contig Information
Length 1253 bp
Clones 25 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 4
Wh_V4816 Shoot grown under cold condition for 16days 4
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 2
Wh_VHS Shoot with heat shock treatment 3
Wh_VWD Shoot grown with dessication 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Sedoheptulose-1,7-bisphosphatase, chloroplastic; AltName: Full=SED(1,7)P2ase; AltName: Full=Sedoheptulose bisphosphatase; Short=SBPase; Flags: Precursor >gi|14265|emb|CAA46507.1| sedoheptulose-1,7-bisphosphatase [Triticum aestivum]
Score 1697
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24165
CCGGCGGGGAGGCAGTCCAAGGCGGCGAGCCGGGCGGCGCTCACCACCCGGTGCGCGATCGGCGACAGCCTGGAGGAGTTCTTGACCAAGGCGACGCCGG
ACAAGAACCTCATCAGGCTGCTGATCTGCATGGGGGAGGCGATGAGGACGATCGCCTTCAAGGTCAGGACGGCGTCCTGCGGCGGCACGGCCTGCGTCAA
CTCCTTCGGCGACGAGCAGCTCGCCGTCGACATGCTCGCCGACAAGCTCCTCTTCGAGGCGTTGGAGTACTCCCATGTCTGCAAGTACGCGTGCTCTGAG
GAAGTCCCCGAGCTGCAGGACATGGGTGGCCCGGTCGAAGGTGGATTCAGTGTGGCGTTCGACCCCCTTGATGGTTCCAGCATTGTGGACACCAACTTCA
CCGTCGGAACCATCTTCGGTGTCTGGCCCGGCGATAAGCTGACGGGCGTCACCGGCGGTGACCAAGTTGCTGCTGCCATGGGCATCTACGGCCCTCGCAC
CACTTTCGTTGTTGCCCTCAAGGACTGCCCTGGGACGCACGAATTCCTTCTTCTCGACGAAGGTAAATGGCAGCATGTCAAGGACACTACAACCATTGGA
GAAGGGAAGATGTTCTCCCCTGGTAACTTGAGGGCCACATTTGATAACCCTGATTACGACAAGCTTGTCAACTACTATGTGAAGGAGAAGTACACGCTGC
GTTACACCGGAGGCATGGTCCCTGATGTCAACCAGATCATCGTGAAGGAGAAGGGCATCTTCACGAACGTGACGTCCCCGACGGCCAAGGCGAAGCTGCG
GCTGCTGTTCGAGGTGGCGCCGCTGGGGTTCTTGATAGAGAAGGCCGGCGGGCACAGCAGCGACGGCAAGCAGTCGGTGCTGGACAAGGTGATCTCCGTC
CTGGACGAGCGGACCCAGGTGGCCTACGGCTCCAAGAACGAGATAATCCGCTTCGAGGAGACCCTCTACGGCTCCTCCAGACTCGCCGCCAGCGCCACCG
TCGGCGCCACCGCCTGATAATCGATCCATCTTCTTTTTTTACGCTTTTTTCAACCTGAAAAACAAGATGTCCGTTATAGAGTTCGTCTGAAGCATGTTGT
TGTCTTGTGACGATGCGAACTGGTAATGCAGCGGGCAGACGGGCTTGCTTACGTCTGCCGCCCTTGTCTCCACTGCGAGGTGATTGTCGGACACCGTTGT
GCGCTTGTGCATGGCATTGGCAACACTTGTGTCATCAGATGTCTGCGTGTCTC
page-top