Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24163  (registered. 2007)
Contig Information
Length 1388 bp
Clones 25 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 6
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 5
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 4
Wh_OKCS Seed DPA5 1
Wh_SHDr Shoot grown with dessication 1
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VHS Shoot with heat shock treatment 1
Wh_VSCB Liquid cultured tissue 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unnamed protein product [Oryza sativa Japonica Group]
Score 1886
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24163
CGTCTTTCGGAAAACATGATTCAACACCACATTACAACAATAATGCCAGAATTCAAATGTATTGCCACTACAGTAGCCTGTTATTTTACTTATGCCAGAT
ACAGTAGTAGAATATATTCAGTTAAGTACACTTTCTGTGTCGAAAGACTGGCAGAGTCAAATTGTTTCTTTGCATCAGGAAACTAAGCTGCCAAACTTTT
CAAAGCTATCTCATAGACATTTTCAGAGAGTCCATTGGCTGAGATGATCATCTCCAGCTGGGCCTTAGCAAGAGCTTGTCTGGTCTCATCATATCTCCTC
CATCGAGAGAACGCTGAAACCATGCGGGATGCCACCTGAGGATTTATTTTGTCGAGCTGTAAGACAACTTCACCCAAGAACTTGTAGCCAGAACCATCTT
TCGCATGAAAACTCACAGGTGACCCACAAAATCCTCCAATTAAAGAGTATACCTTGTTCGGATTCCGCATGTCAAAAGCAGGATGAGCCAGTAACTTTTG
AACATTGGCTACATTTCCAGGAATGTCCGAGGTAGCTTGAAGAGCAAACCACTTGCTTACAACCAAATAATCTTGCTGCCATTTGTTATAGAAGTCCAAA
AGGGCATCCTCACGGACTTGACCTGGATTTTGAGACAATGCTGCTAATGCAGCAAACTGCTCGGTCATGTTAGTAGCAGACTTGTATTCATTTAATGCAA
GTTCAGTGACATCTGGCTCATTCAGGGATGCAAGATAAGCAAGACATGTATTTTTCAACGCACGGCGAGCCACGCTATCATGGTTAAATGCATAAGCTTC
AGAGCTTCTGTTGCTTGTTACAGCTGCGAGAAGATCGTCCTTGAGTTGAAAGGCGAGTTCTTTCTTAATAAAGGTCCGGACAGCATGAACTGCATCGGGA
TCTGCAATTGACATCATATCCATAATCTCACCTTGACCAGGCAGAGTTATTGCTTTTGCAATGAATTCTTTATCCAAGCTTGTGCTTCGCAGGATTGCTC
TAAGTCCATCAACAAATTTTGTATTTAGGGCCAGTGTTTTCTGTTGTTGGAAGTCAGCCACAAGACTGAACATCAATTTGCGTGCCAATATTTGACCTGC
TTCCCATCTGTTAAATTCATCTGAATCATTGGCAAGTAAGAAATATAAGTCACTCTCAGTCAGATCAGAATCAAGACGGATGGGAGCACTGTATCCCCTC
AACAAGGAAGGAACTGGTCTCTCAGGCACATTATTGAATATAAACTCTTCCTCCTTCTTCTTAAACTGAAGCACTGTGGTGAAGATTGGATGACCATCAT
TAGAGAGTGTTTGGACCCTTCCGTCACTGTAGATGGAAGTCAGGGGCATATCTTTTCCGGTCGAATCAACAAGTCCAACAGCAACAGG
page-top