Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24117  (registered. 2007)
Contig Information
Length 1227 bp
Clones 24 Clones [Download: TSV  ,  FASTA ]
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VABA Shoot with ABA treatment 5
Wh_VHS Shoot with heat shock treatment 12
Wh_VWD Shoot grown with dessication 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0208000 [Oryza sativa (japonica cultivar-group)] >gi|53749331|gb|AAU90190.1| putative 2-oxoglutarate/malate translocator [Oryza sativa (japonica cultivar-group)] >gi|113578455|dbj|BAF16818.1| Os05g0208000 [Oryza sativa (japonica cultivar-group)] >gi|125551229|gb|EAY96938.1| hypothetical protein OsI_18855 [Oryza sativa Indica Group] >gi|215701101|dbj|BAG92525.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765355|dbj|BAG87052.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1305
Evalue 9.35421e-142
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24117
TTTTTTTTTTACCCAGAAATGATATGATTATTTCTTCTGAAAGACACAGAGAACAATGGTAGCATATAGGCCAAGGCAGATAAGTACAGATTTTGTCTAT
CAGAACCAACTGCTGATTTATACTGTAGGTACAAAGCAGCTACACTATTATAATTTGTCGGCAAGGATAGCATAGCACGGCACTTTAAAGGCCGACACGC
TTCTCGACCTTCTGGATCTGATTCAAGAATATCCAAGTCATCATGACATGTGGAGCAATCCTGACACAGTAGACCGGAAAGCCAGTGTAGAACTTAAATG
GACCACCACTCTTCAAGGTCTTCATTGCACAGTCAAGAGACCCAGTGTATGGATACTTTCCAGTAGCATCAGGTTGCATCTTCTGAACCTGTGTCTTAAC
ATAGTCGAAGGGCAAACTGCAAGCAGACGCGAAGAATCCTGAAACAGCACTGGCCCCAAGCATTGTAGAAAGTTCACCAGCACCAAGTTTGTCTCTAAGT
ACCTCAACACTCTGATCATAGGAGGCAAGCATGCCCATGTTTAGTGACATCGCTCTAGCTACAGTTGGACCTGCGCCCTTCCAAAGTGCCAGAACACCTT
CATCAGCAATAATACGATAAAGTGCATGAAAAGCATTCTTATAGTGGCGGCGCTGGGCTGCTGGCAAGGTTGAATCAGCCTGCATCCTAATGAGTGCCAA
ATCCGCAGGACTACCAAAACACGCTCCAATCGCTCCAGCAGTGAGACCAATAGCAGCCTTCTGGACTAAGGGCAGTGGTTTTCCTTCGTTTGCTTCAACT
GCTTTATTTGTGAGAACCCTGAAGGATCCAAGTCGAGCGGTTGTGTATGTCGCTTGCCTTAGCAAGCCAGCAGATAATCCCTTGTAAAAGGAACCAACTC
CCTCATTAGCAAGCATCTTCTTGGTGACAGAAGTTGCAGAGCCCTCGCCCAACTGGATCTTCACCTTGACCATGTCGATGGGCTGGATGACGCAGGTGGC
GAGCATGCCGGAGGCGCCGCCGTTCACGAAGGGCTTCACCGTCTTCCAGACGCCGCTGGCCGCCAACGCCGTCTGCGGCGGCTGCTGCTGCTTCGCATCC
GCCATCTCCTCCGCCTCGTATCAACTCCCACCGATCCTGAGCTAGGAGGAGCTCCCGCGCTGCTGTCTGGGCTTCCGGAGAAGCAGAGGTGGTGGGAAAC
AGGGGGCTAGGAGGCGACGGGGACGTG
page-top