Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11925  (registered. 2012)
Contig Information
Length 1566 bp
Clones alternative view 146 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 5
Wh_e Seed DPA10 4
Wh_f Spike at flowering date 3
Wh_h Spike at heading date 4
Wh_oh Pistil at heading date 2
Wh_r Root 2
Wh_yd Spikelet at late flowering 4
Wh_SH - 3
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 3
Wh_EMI Dormant seed with water absorption after breaking 7
Wh_KMP Shoot grown under continuous light 3
Wh_RDr Root of dessiccated seed 2
Wh_SHDr Shoot grown with dessication 9
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_VSCB Liquid cultured tissue 11
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 3
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 4
WH_XN Leaves, plant was grown at constant 23 15
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 9
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 3
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_SP 2
WH_XA Root 1
WH_XB Root 11
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 8
WH_XF Seedling, infected with leaf rust 6
WH_XV Leaves, plant was grown at constant 23 6
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115464703|ref|NP_001055951.1|| Os05g0498700 [Oryza sativa (japonica cultivar-group)]
Score 566
Evalue 3.00E-159
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig11925
TTTTTTTTTTAGAGCAGCAACGAGTATAATTGCAAGGTTTCCAACACAGGCGGCACAGAAACAGCAGCATCAAGTCAAATGCAAGGTTCCAGCTTTCCAA
ACCAAGGTAAGGTACAAAGACAACAAGGGTACACTCCCAACATCACCCGCCCTCACTTTGGGGCATTCATGATGCATCACAACAGTATCCCCCGTCTTTC
GGGGTTTCCCCGCTGACGGCGGGCATACTGCACTACAAATACATAAATATGAAGAAGAACATACACATCACCAAGATTACGGACAGACGGCACCGACACA
GACAGGCTCACATCTTTAGAGGCCTACTTCTTCCGAGTACCAGGTCCTTTCTGGGGGAAATGCAACCACCAACCAACAGCTTGCGCTTTCATGGACGAAG
GACGGAACAGATCATTGTGAAAACATCTTCCACAACTTACAGGGATGATATTTACTAAAAAGAACCACAGAGCAACCACAACCATGTTCCGAAGCCGATC
AGGCGTCTTCTGTCTTGCACAGGTCTAGCAGTGACAGTGTCTCTGCTATGGAGAGCTCCAGGCGGAATTTAGGACCATCATAGTGGTGCAGCACTGGCCT
GAAAGCATCCTCTTCCAAGGCCTTGCAAAGCCTTCTAATGCGGATCCTCACCTGTGCTGGGAATCTGGATTCACCTTTGCACTTCTTATCTTCCCAAGCA
GTGGGATCAATGTTTGATCCTCCAAAACTGGCAGCCTCAAACACCCCATGTAGCTGATGGGTCGTGTAGTTGTAGAGGAAAAGAGGTAGACCAGGAGTGA
TGGCTCGGACTGAATCACGATATCTTGCTGGCAAGCCAAAAAGCTGTCTCTTGAGATCCTCCTGCATGGTATCATTGTTGCAGACAAAGATGTATCCACC
AAGAACTTCATTCCTCGGTAGCATCTCGCTTGTTGGCAATGTTTTGAAGCGCTTGTCAACAGAGTTGTTGTTGCTGTTGCCTCCATTGTTGTTGTTACCA
CCATTGTGTTTGCCGTTTGTTTCCTTCCCATTCTGATTATTGGGATATTTGTTGACCCCAACATTCATCTTGAACGAATTGACATTACCGTTGTTTCCCT
TGGGGTACATCGGATTCATGTTATAGGCCATGTTGCGGAAAGGGTACTTCATGGCAGCCTCGTTCATCTTGAGATCATTCATCTTAAGATCCAGGTTCAT
CAAGCCAAGATTGAGGTGGTCCATCTTGTTGTCTTCTTGGTGGTAGGATAGCTTATCCCATTGCTTGACATCAGGGACGGTGTTCATCCGTGCATACTCA
AAGTCATTCATCCTCTCAGCCTTTGACTTTGTGATCTCAGCAAGCTTTGATGTCATGAGAGACCATTGGCGGTCCTCCACCACCTTTGATTGCCCACGGA
ACTCATCTCCGAGATGCCACAAGTTGTCCATAGCTCAGTTCAAGCTCTCTGCTCGATTCGGCGCCGGATTCCGGCGGGGAGGGCGCTGGATTTGGGGAAA
CTGCTGCGGGGAAGGGGAAGAGGAGGATAGGAGTCGGCTCGGCTGGCTTGGCGTTGGCTCCCACTT
page-top