Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24098  (registered. 2007)
Contig Information
Length 1593 bp
Clones 24 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 4
Wh_KMP Shoot grown under continuous light 3
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 6
Wh_SHC Shoot grown with cold treatment 2
Wh_VABA Shoot with ABA treatment 2
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_30819 [Oryza sativa Indica Group]
Score 1213
Evalue 6.19286e-131
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24098
GGACTTTACCAGTTTACAGCTTTGCAATGGGCCATCCAATACAGTCCCGGGTCCGACCAGCTTAGCAGCCAGCAAGTCTTTGCTTCTGGCTTCATCACCG
TGCAGACAACCAAACTTCAGACTTCGCGTAGCAAGTCAACTATGTATACATACTGCTTGCTCAAGAGCAAGAAGATCGAAATAGCGCAACATTTTCATCG
CTGTGGACGACAAAGCACTCCACTAGGTAATGTACAGCTGATCCTTACGAGGCTAACTATCCAGTTAACACAAACCAAACCTCTATTAAACACTGAAAAC
CCATACAGAGGTTCACGAAACGACAGCTCTACAATACACCAAACTGTGCAGGAGAAAACAGCTCTGCCCTGCCATGTGCGTCGAAAACAAGCCCATGAGG
AAGGTCAGGACGATCATGGTACTTCAGGTAGTCGTCTGATCCAGTCCTCCTTAGTTTCCGTATCTCCTGCCAGACTCCATGGTGTCAAGAATAGGACTCG
TGTCTCTTAGGGCGATCCCGCCCTGACCTTCCCCTTCTTCAGTCTCCGTGGGTGGTCGCAAGCTGAAGGAGTTTGCAATGCCACTGTTGCGTGCCTCGGC
TAGCTGGAGCGTGTATGCATGAGGCCACAGTCCATCTGCATCATAAGGATATGGGAAAAATTGCAGGTAACAAAATGAAGCCACTGTGAGACCTAGAACA
GCTCCTGCAACCACATCTTGCCAGTGATGCCAGTAGTCATCCACTCGAGAAACAGCAACAAGTGCAGCAGTAAGTAGAGGCAGAACAATAATGCACAGCT
TTGCAATATGACCTTTACGGTCAAAAACTGCGATTTTCCCAGTCAAGTACCATGTAAGGAAGCCTAGGCCGGCGAAAGACCATGATGAGTGTCCACTTGG
GAAGCTCTTGTGACCTTCTTTGATGACACTCTTCTCTCCATGGCACAGAACGCCAGTAGTGACATTATCATAAAGATCCTTTCCATCTGGGAAACAGCGC
CAGAAGAAATCAGGACGTGGTCGGCCAACTCCATCCTTAATTGCATCAGTAATCACCGCAGTTATGAGCACCGAATAAAGAATACCCAGTATGCCATGGT
GCAAATCATAGATATTCTTCTTCTTGAAGTAAATTCCACCAAAGATGACACATGGCAAGACAATTCCAATGAGCGGAACAGCCCAAAAGGGCACAGTATT
GCCCTTTAATGGATATCTCAAGTCAGTCATCATGTCCTTCCCAATGAAGCGGTGAAAAGGCTCAATTATATTCAACAGTCCATCTATGACAGCAAGGAGG
AGAAGTATTATCCAGTCATACATGTGGAGTCTAGCCACTTTGGCTCCATGGGACTTTATAGTGTAACATCCTAACTGGATATCCGCCATTATGTCCGACG
AGAGAAGGAACCGAGCGGAGTCGGATCTCCAGCGCTCCGCCCTGGAGGATGCCGGGGAGAAGACGGTGTTCCGCGCCGCCGGCGACGGTGGGCCGCGCGA
CGGATGGATTGCGGGGCTGGAAAAGAAGAAGAGGAGACGAGGGTTGGTGAGGGGATTATTAGTGCTTGCTTTGTCCTTTTGTTTTGACGAGTA
page-top