Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24071  (registered. 2007)
Contig Information
Length 1065 bp
Clones 23 Clones [Download: TSV  ,  FASTA ]
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 6
Wh_VABA Shoot with ABA treatment 6
Wh_VHS Shoot with heat shock treatment 3
Wh_VWD Shoot grown with dessication 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0556800 [Oryza sativa (japonica cultivar-group)] >gi|46389866|dbj|BAD15467.1| proline-rich family protein-like [Oryza sativa Japonica Group] >gi|113536664|dbj|BAF09047.1| Os02g0556800 [Oryza sativa (japonica cultivar-group)] >gi|125539889|gb|EAY86284.1| hypothetical protein OsI_07655 [Oryza sativa Indica Group] >gi|215712358|dbj|BAG94485.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765806|dbj|BAG87503.1| unnamed protein product [Oryza sativa Japonica Group]
Score 580
Evalue 8.85399e-58
Total Hit Count 176
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24071
AAAACTGGAGTATATTTTCGTGGAGATGTTGTAACATGATTGCAACTGGTATGCAAGATAAGTAACTGGAACACCAAGCGAACCACCCGGCATAGACCGC
GTGTACAAAATAAAGAGTAGACTTCACTCATGAGTGAAGAACGGCGTGTCAAACTCTTCAAACTCTAGCGTTGTATCGAATTGCTAATACAAAAGCTCGT
GCCTGTCTTCCACATCAAATTTATGCTTCGATTATTTCCGTCTCACGCTCACCGTGTATATGATTATCAGCTCACGACGACGGCTGCTCCGCGGTTGCCG
AAGTTTCCGCCTCTAAGGTGGGTGAATCAGATTCAGAAGGCGTCTCCTCGGGCGCGGCCGCTTCCACGACAGGGGGGCTCGACTGGACCGAGAATGCCGC
GGCGGCCGGCTGGAACTTGGCGACGTAGTAGCTGAGAGGCGGGCCGGAGTATTGGGTCTGCACGGGCGGCTGGTTCTTGCTCACCTGGATGAGGATGGAG
GCCGCCCCGGCGACGAAGATGAGGGCCAGCCCTCCCGTGAGCGCCGCCGTGTTCTCGGACCCATCGGACGACGTCCCCGCCGTGCCGGAGCTGATGGCGC
TCTCCGCCACGTACACCGCCGGCTCGATGGAGTAGATGTTGGTCTGGCCGGCGGTGTCCTTCTCGACGAGGCCGGTCCATCCTTTCTTCTTGGGAGGGAA
TGTTCCCACGACCTTGGTCCTCTCCTCCGCCAGCCACTCCACGCTCAGGCTCCCGACCTCCTTCTCCGGCGCGCACTCCACGTCGTTGCACTCGGAGTCG
TCCGGAGACGAAGAAGCATTGCAGGACAGTGTCAAGAACCTGTTGCCGCCGTTGATTCCTCCTCCTCCTCGCGGAATCGTGGCCTGCTGGGGCTTGCTGC
TCCTCAGGAGCACGCAGCTGCTAGCAGAGAGCATGGATTGGGCAGGGCAAGCCATCTTCTTCTCTCAATTCTCTCAGTCTCGCTCGCTCGCTTGCTCTAG
CCTTAGACACACCAGAAAACGAGTGAGTGGGAGGATATGGCTGTGGACTCGTGAACACCACCCTC
page-top