Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24068  (registered. 2007)
Contig Information
Length 1913 bp
Clones 23 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 8
Wh_V4816 Shoot grown under cold condition for 16days 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit inducible phenylalanine ammonia-lyase [Triticum aestivum]
Score 2598
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24068
TTTTTTTTTTGAACGAAACCCACTCTTCGACCCACAATGCAAAACTGCCAGTGTCCATCATTAAGAAACAAAGGCGATAACACGGTGTATTATGAAACAA
AGTAATGTACTTAAGCTCCCATCATACAAGTTACAACAACACAAGTTTGAGAAGCTGCCTGCCTCGCCTGCTCATGGCATGGCGGCAGCGAGAAAAAACA
ACAGTAGTATCAACTTAACTAAGTACAATGAAACGTAGATATACCAGGAACCTCCCGCTTCACAGTCTTGAACCACTTCTATATTCACTTTGTGTGTACG
TGTTTTCTTTTCCTTTGGTGTTACCTTGTCTCGTCGGCTGCTCAGCAGAGCGGCAGGGGCTCGCCGTTCCACTCCTTGAGGCACTCCAGCAGCGGGTCGA
TGTGCTTGCGCTCGTTCATGGCCACCAGCACCTTGTTCAGCTCCTCCCCGGGCGACCGCGTCTTCTCGCCGGTCAGGTACTCGGTGCCGCACACCTCGCG
CACGAACTGGTACAGCGGGTAGGAGCGGCAGTCCTTGATCCGGTTGGGAGCCAGCGGCGTGCCGTTCTCCACGGACGCGCGCGCGGCTTCCACCTCCTTG
GGCAGCACCGCGCGGATGTTCTGCTCGAACTCCGCCACCTTGGCGAAGATGGAGGTCTCCAGGGCGCGCTCGCCGTCGCCGTTGGCCAGCGCGTGCTCCA
CCAGCACCGCCCGCAGCTTCTGCATCAGCGGGTAGTTGGGGCTGCACGGGTCGTCCGCGTACGCGAACACCGCCTCGCGGTCGATCGCGGTCAGCAGATC
CTTCTCGCAGAAGCGGGCGATGTGGAGGCCGCCCATGTTGTTCATGCTCAGGGTCTTCTTGGCCACCTGCATCACGCAGTTCCTCACCGCTGTCTTCATG
TTCTCCTCAATGTGGCGAAGGTCAATGGCCTGGCACAGAGCCACCAGGAACGTGGAAGACATGATCTTCAAGATGTCAATAGCCTCGGCGGTCTTCCTGG
ATGAGATCAGACCAAGTGAGTTCACATCCTGGTTGTGCTGCTCCGCGCTCTGGACATGGTTAGTCACCGGGTTGCCCAAGAACTGCAGCTCAGAGCAGTA
CGAGGCCATGGCGATCTCGGCGCCCTTGAAACCATAGTCCAAGCTCGGGTTGCGCCCACCGGACAGGTTGGAAGGCAGGCCATTGTTGTAGAAGTCGTTC
ACGAGCTCCGAGAACTGCGCGAACATCAGCTTGCCAATAGCAGCAATGGCGAGGCGGGTGTTGTCCATGGAGACACCAATGGGGGTGCCTTGGAAGTTGC
CACCGTGGATGGCCTTGCCACGGGAGACGTCGATGAGCGGGTTGTCGTTGACAGAGTTGATCTCACGCTCAATCGACTTGGTGGCAAATCGAATAACTTC
GATTTGTGGGCCGAGCCACTGAGGCGAAGTGCGGAGGGCATACCGGTCCTGCTTCGGCTTCATCAAGGGGTCGAGCTCGCCAAGCTTCTTTGCCTGCTTC
ATGTATGAGCTTCCCTCCAAGATGTGCTCCATGATTGCAGCTGCTTCAATCTGTCCAGGGTGGTGCTTCAGCTTGTGGGTCAGGTGGTCAGTGAACTCCG
GCTTGCCGTTCATCACCTCGCAGAACACCGCAGACAAGACCTCAGCAAGGACGGACAGAACATTGGCCTCAAAGAGCACGGTCGATGCAAGACCAGAGCC
CACAGCCGTGCCGTTCACCATGGCAAGGCCCTCCTTGGGCTGCAGCTCAAAGAACCCGTGCTCGATCCCGGCGATCTTGAATGCCTCGGCAGCGGTCACC
TTGCTGCCATCAGGGGCCACCGCAACAGAGTTCTGTCGGCCGGTGATAAGGCCGGCAATGTAGGACAGCGGCACAAGGTCACCGGATGCAGTGATGGTGC
CCCGGAGCGGCAA
page-top