Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24055  (registered. 2007)
Contig Information
Length 1941 bp
Clones 23 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 7
Wh_DPA20 Seed DPA20 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_OKCS Seed DPA5 6
Wh_PCDAM Anther at meiosis 2
Wh_VHS Shoot with heat shock treatment 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0118400 [Oryza sativa (japonica cultivar-group)] >gi|38344860|emb|CAE01286.2| OSJNBa0020P07.3 [Oryza sativa (japonica cultivar-group)] >gi|113563628|dbj|BAF13971.1| Os04g0118400 [Oryza sativa (japonica cultivar-group)] >gi|116308871|emb|CAH66007.1| H0613H07.5 [Oryza sativa (indica cultivar-group)] >gi|119395218|gb|ABL74570.1| elongation factor [Oryza sativa (japonica cultivar-group)] >gi|125589153|gb|EAZ29503.1| hypothetical protein OsJ_012986 [Oryza sativa (japonica cultivar-group)] >gi|215704910|dbj|BAG94938.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215715300|dbj|BAG95051.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1561
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24055
CAGGCAAGCTCTCACGATATAAAACGAAAGAAAACACGACATCAACAAGAACTACCGGTGGATAACAGATATATAATCTAAGTTTTAACATCGATAGACA
TCAAAACAAAGTGCCAGTATCACGACAGATAGGAGTACATTCCAATAGCAATACAGCCACGACTCAGTAGACACAAAATAATAGTGCAGCTCTCTTAGCA
GCAAAACCAACTACACTATATAGGAGATAACAGAACCAAAAGTTTAGAGCTTGTCCTCGAAATCAGACAGAGGGGTCATCTGTTCCTTCAGACCCTTGCG
CTTGCGGATCTCCGTGACAAGGGTGGCAGACTGGGAGCCGGCCTCCAAAGGATCCGAAGACATGATGTCCCAGTGATCGAACACACACTGGGGGAAAGCC
TGGCCAGATGTCGCAGCCCTGAGGGTACTTGAGAACCCGAACGACTCGATGACCGGGAGGTAAGCCTTGATGTTGTACAGCGGGGTACCAGGCCTCTGCA
TCTCCTCAAACACGTGCCCTCTCTTCTGATTCAGAACACCATAGATACCGCCAAGTGCATTCTCCGGGGCCTGGATCTCAACCAGGTACACAGGCTCCAG
CAGCCTTGGCTTAGCAGTGAGCTGAGAAGCATAAATGACCCTCCTGGCTGTTGGGATGACCTGGCCACCACCCCTGTGAATAGCATCAGTGTGCAGAACA
ACATCACAGACCTCAAAGCAGATGCCACGCATGTTCTCCTCAGCCAAAGCACCTTCTTTCGATGCCCACTGGAACCCAGCCACAACAGAGTCCTTGATTT
CATTCAGATACTGCACTCCCTTACACATGTCGACAACCATGTTGGGGCCAGTCGTCTCAGGTCCAAAGCACCAAATCTTCTTGGCAAGATCCTTGTCCCA
GCCAAACTCCTCAGATAGGATCTTAGAGCGCACCTTAGGATCATCACGTGGGGCCAATGCGGCCATCATCAATGGCCTCAGCCAGTCCCTCCTCCAATGG
GCGAGCCTCCATGTAAAGACGGTTGTGCTTGTTCGGGGACTTGCTCATAACTGTGCGGCAGGACTTCTCCAGAACAGTCTCACGGAAGGAGACAACAGGA
GGTGAGACAATAATTTCAGCACCACCCATGAAGTCCTCCTGCAGATCCTTCAAACAGATTTCAAGGTGAAGCTCACCAGCTCCAGCAATGATATGCTCAC
CAGACTCTTCAATGCTACAGAGAACCATAGGGTCAGACTTCGCCAGCCGCTTCAAACCCTCAACAAGCTTAGGAAGATCAGATGCCACCTTGCACTGAAC
GGCAACACGCACAACAGGGGACACAGAGAACTTCATAGCCCTGATTGGGCAGGCATCAACTTCCTTCTCATTTGTCAGGGTTGCATTCTTGGTGATGAAC
TGATCCAAACCAACCAAAGCAACAGTGTTACCACAGGGAACATCCTCAACAGACTCTTGCTTCTTTCCCATCCAGATAACAGTACGCTGGACACTCTTCA
CATACAGATCCTTCTTCTGGCCAGGAACAAAGTTGGGACCCATGATACGGACCTTCATGCCAGTTGCAACCCTCCCAGCAAAAACACGTCCAAAGGCAAA
GAATCTACCCTTGTCAGATGCTGGAATCATCTTGGAGACATACAACATCAGAGGACCTTCAGGGTCACAGTTCCTGATAGCATTTGCATATATATCATCA
AGAGGCCCCTCATATAAGTTCTCCACACGATACCTCTGTGCCTTCGAAGGAGAGGGGAGGTGAAATATCATCATCTCAAGCAGAGCACGACTGGCAGGCA
GCCAAGTTTGCATCACACGCTTCATGAGAGCCTTGCCCATCAAGTCCTTCTCATCATTCTTCATGGTCACACCCAGCTTCTTCAACATAGGCCACAACTT
ATCCTTCTGATCATTCATGCAGGTGGCGATGATTTGCTTGA
page-top