Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24024  (registered. 2007)
Contig Information
Length 2296 bp
Clones 23 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_EMI Dormant seed with water absorption after breaking 7
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 4
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit HSP70 [Triticum aestivum]
Score 2546
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24024
TTTTTTTTTTAAAAACGAGAAGCTCTAAGCTTCAAGGGTTCCAAACCAAAGCAAACATCATGATCCATCATGTCCTTCAGACCAACGACTCCATCGAACG
ACTACTACTACTTCCAGCTAGATGACACAACGACAGACGACTGACACCACCGAGCGGCATCCAAAGGACGGACACCGAGACAGCGAACCCATCAAGTAGC
GCGCAGACCGGAGACCACCACGGGCACGGACCAACAAATTAGTCCACCTCCTCGATCTTGGGGCCAGCGCCGCCGCCGCCGGCCGGCATGTCCTCGTCCA
TGCCCATGCCGCCGCCCATGTCCGGCGCGGCGCCCTGGTACATCTTGGCGATGATGGGGTTGCAGATGCCCTCCAGCTCCTTCATCTTGTCCTCGAACTC
GTCGGCCTCGGCGAGCTGGTTGGCGTCCAGCCAGCTGATGGTGCCCTCGATCGCCTCCTCCACCTTCTTCTTGTCGTCCGCGCCGAGCTTGGAGGCGATC
TTGTCGTCCTTGACCGTGTTGCGCATGTTGTAGGCGTAGTTCTCCAGCGCGTTCTTGGCGTCCACCTTCTTCTTGTGCTCCTCGTCCTCCGCCTTGTACC
TCTCCGCCTCCTGCACCATCTTCTCAATCTCCTCCTTGCTCAGCCGCCCCCTTGTCGTTGGTGATGGTGATCTTGTTCTTCTGCCCCGTCGTCTTGTCCT
CCGCAGACACGTTCAGGATGCCGTTGGCGTCGATGTCGAAGCACACCGTGATCTGGGGCACACCGCGGGGCGCCGGCGGGATGCCGGAGAGCTCGAACTT
GCCCAGGAGGTTGTTGTCCTTGGTCCTGGCGCGCTCGCCCTCGTACACCTGGATCAGGACGCCCGGCTGGTTGTCCGAGTAGGTGGAGAAGACCTGCTCC
TTCTTGGTGGGGATGGTGGTGTTCCTCGGGATGAGCGTCGTCATGACGCCGCCGGCGGTCTCCAGACCCAGGGAGAGAGGCGTCACGTCGAGCAGCAGCA
GGTCCTGCACCTTCTCGTTGCCCTCTCCGCTCAGGATGGCAGCCTGGACGGAGGCGCCATACGCCACTGCCTCGTCGGGGTTGATGCTCTTGCACAGCTC
CTTGCCGTTGAAGAAGTCCTGGAGCAACTGCTGCACCTTGGGGATACGGGTGGAGCCACCGACCAGCACCACGTCGTGCACCGTGCTCTTGTCCATCTTG
GCGTCGCGGAGGCACTTCTCCACCGGCTCCATGCACTTGCGGAAGAGGTCCATGTTGAGCTCCTCAAAGCGAGCCCGTGTGATGGTAGTGTAGAAGTCCA
CACCCTCGTACAGCGAGTCGATCTCGATGGTGGTTTGGGCCGTCGACGACAGCGTGCGCTTGGCACGCTCGCACGCCGTGCGGAGACGACGAAGAGCGCG
GGGGTTGCCGGTGATGTCCTTCTTGTGCTTGCGCTTGAACTCCTGGACGAAGTGGTTCACCATGCGGTTGTCGAAGTCCTCCCCACCCAGGTGAGTGTCA
CCGGCGGTGGCCTTCACCTCGAAGATGCCCTCCTCGATGGTCAGCAGCGACACATCGAAAGTGCCACCGCCAAGGTCGAAGATGAGGACGTTCTTCTCAC
CGGTGCTGGTCGCCTTCTTGTCAAGGCCGTAGGCGATGGCAGCAGCAGTGGGCTCGTTGATGATGCGCAGCACGTTCAGCCCGGCGATGGCGCCGGCGTC
CTTAGTGGCCTGGCGCTGGGAGTCGTTGAAGTAGGCCGGAACGGTGACCACGGCGTTCTTGACAGAGTTGCCGAGGAAGGCCTCAGCGATCTCCCTCATC
TTGATAAGCACCATGGAGGAGATCTCCTCCGCTGCGAACTGCTTCTCCTCACCCTTGTAGTTGACGACGATCATGGGCTTGTCTGCAGGGCCAGGGATGA
CCTTGAAGGGCCACAGCTTCATGTCACTCTGCACGGAGGGGTCAGAGAACCTCCTGCCAATCAGCCGCTTCGCATCGAAGACGGTGTTGGTGGGGTTCAT
GGCGACCTGGTTCTTGGCGGCGTCGCCGATGAGGCGCTCGGTGTCGGTGAAGGCGACGTAGGAGGGCGTGGTGCGGTTGCCCTGGTCGTTGGCGATGATC
TCGACCCGGTCATGCTGCCAGACGCCGACGCACGAGTAGGTCGTCCCGAGGTCGATGCCGATCGCCGGCCCCTCGCCCTTGGCCATCTCCGCCTCCTCTC
CTCTCCTGGGAATCGCTCGCTCGCTCTCTCGCTTTGGGGTTCGCCGGAAGACCCTCTGAGTTTGCCTGGTGCGATTTGCTTTGCCCCTCTCTGATT
page-top